\
| Variant ID: vg1204509767 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4509767 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 245. )
ATCATAGTAATTTCTTGTTAATTAATTACGAACCATCAGTGATATCAGTGTCATCTCTAAAGGAACCGATAGTGATGAGTCATCTGGTAAAAACACCAAC[G/A]
ACTTGGGCTCATTGACGAAATCAGTCGTGTTTGTGTTCTTGCAACTTAGGGCTTGTTTGGTTAGTGACCTGAGCAACATGATTGATAAAAACGTATGTCT
AGACATACGTTTTTATCAATCATGTTGCTCAGGTCACTAACCAAACAAGCCCTAAGTTGCAAGAACACAAACACGACTGATTTCGTCAATGAGCCCAAGT[C/T]
GTTGGTGTTTTTACCAGATGACTCATCACTATCGGTTCCTTTAGAGATGACACTGATATCACTGATGGTTCGTAATTAATTAACAAGAAATTACTATGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 34.40% | 0.00% | 0.32% | NA |
| All Indica | 2759 | 96.70% | 3.10% | 0.00% | 0.18% | NA |
| All Japonica | 1512 | 14.20% | 85.50% | 0.00% | 0.26% | NA |
| Aus | 269 | 62.80% | 37.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 97.60% | 2.30% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 94.40% | 5.20% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 4.70% | 95.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 13.90% | 85.50% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 45.20% | 54.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 95.80% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 33.30% | 62.20% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204509767 | G -> DEL | N | N | silent_mutation | Average:48.95; most accessible tissue: Minghui63 flag leaf, score: 85.67 | N | N | N | N |
| vg1204509767 | G -> A | LOC_Os12g08770.1 | downstream_gene_variant ; 1888.0bp to feature; MODIFIER | silent_mutation | Average:48.95; most accessible tissue: Minghui63 flag leaf, score: 85.67 | N | N | N | N |
| vg1204509767 | G -> A | LOC_Os12g08770-LOC_Os12g08780 | intergenic_region ; MODIFIER | silent_mutation | Average:48.95; most accessible tissue: Minghui63 flag leaf, score: 85.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204509767 | NA | 5.26E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | 4.44E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 2.95E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 5.60E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 1.45E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 4.70E-08 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | 7.10E-06 | NA | mr1247 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 6.05E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 1.84E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | 3.25E-06 | NA | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | 9.62E-06 | 1.25E-08 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | 2.22E-06 | 9.97E-13 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 2.13E-06 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 6.20E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 2.16E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 5.53E-08 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 1.18E-15 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 4.57E-07 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 1.40E-07 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 1.82E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 3.96E-07 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 2.64E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 4.29E-07 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 2.16E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 5.36E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 9.59E-09 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 9.24E-07 | mr1594_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 6.13E-09 | mr1691_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 7.66E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204509767 | NA | 1.57E-07 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |