\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204382817:

Variant ID: vg1204382817 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4382817
Reference Allele: TAlternative Allele: A,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGCGGACAACCGCCGAAGGGAACTCACTTTTGAAGCAGGGGATTACATGTATCTCCGTGTTACTCCGCTCCGGGGAGTACACCGTTTCCAGACAAAAGG[T/A,C]
AAGTTGGCACCACGCTTCGTGGGACCATACAAAATCTTGGAACGAAGAGGAGAAGTGGCTTATCAGCTAGAACTTCCATCCAACATGATCGGTATCCATG

Reverse complement sequence

CATGGATACCGATCATGTTGGATGGAAGTTCTAGCTGATAAGCCACTTCTCCTCTTCGTTCCAAGATTTTGTATGGTCCCACGAAGCGTGGTGCCAACTT[A/T,G]
CCTTTTGTCTGGAAACGGTGTACTCCCCGGAGCGGAGTAACACGGAGATACATGTAATCCCCTGCTTCAAAAGTGAGTTCCCTTCGGCGGTTGTCCGCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.30% 0.70% 2.98% 64.62% C: 0.44%
All Indica  2759 18.90% 1.10% 2.46% 77.06% C: 0.43%
All Japonica  1512 55.50% 0.00% 3.70% 40.74% C: 0.07%
Aus  269 24.90% 0.00% 2.60% 69.89% C: 2.60%
Indica I  595 32.30% 0.00% 5.04% 62.02% C: 0.67%
Indica II  465 27.30% 1.10% 0.65% 70.75% C: 0.22%
Indica III  913 2.40% 1.40% 1.31% 94.63% C: 0.22%
Indica Intermediate  786 23.00% 1.70% 2.93% 71.76% C: 0.64%
Temperate Japonica  767 80.20% 0.00% 5.48% 14.21% C: 0.13%
Tropical Japonica  504 28.00% 0.00% 0.60% 71.43% NA
Japonica Intermediate  241 34.40% 0.00% 4.56% 61.00% NA
VI/Aromatic  96 16.70% 0.00% 8.33% 75.00% NA
Intermediate  90 38.90% 0.00% 2.22% 57.78% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204382817 T -> C LOC_Os12g08620.1 synonymous_variant ; p.Gly1099Gly; LOW synonymous_codon Average:10.577; most accessible tissue: Callus, score: 32.968 N N N N
vg1204382817 T -> DEL LOC_Os12g08620.1 N frameshift_variant Average:10.577; most accessible tissue: Callus, score: 32.968 N N N N
vg1204382817 T -> A LOC_Os12g08620.1 synonymous_variant ; p.Gly1099Gly; LOW synonymous_codon Average:10.577; most accessible tissue: Callus, score: 32.968 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204382817 NA 2.60E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 1.95E-09 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 2.74E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 7.66E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 2.97E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 1.33E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 8.81E-23 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 1.18E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 1.49E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 3.07E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 1.83E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 1.27E-12 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 4.34E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 7.90E-15 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 1.53E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 NA 1.53E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204382817 4.96E-06 9.97E-10 mr1942_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251