\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204328784:

Variant ID: vg1204328784 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4328784
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGACCAGCGATGTAGCATTTCTTCCACTACTTACACTTTAAGTGGTCGAGTTACGACTACTGCCTGGTCCTCGACCAGTGATGTAGCGTTTCTCCCAC[T/C]
ACTTCCACTTCAAGTGGTCGAGTCACGACTACTGCCTGGTCCTCGACCAGCGATGTAGCGTTTCTCCCACTACTTCCACTTTAAGTGGTCGAGTTACGAC

Reverse complement sequence

GTCGTAACTCGACCACTTAAAGTGGAAGTAGTGGGAGAAACGCTACATCGCTGGTCGAGGACCAGGCAGTAGTCGTGACTCGACCACTTGAAGTGGAAGT[A/G]
GTGGGAGAAACGCTACATCACTGGTCGAGGACCAGGCAGTAGTCGTAACTCGACCACTTAAAGTGTAAGTAGTGGAAGAAATGCTACATCGCTGGTCGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 0.90% 6.24% 39.04% NA
All Indica  2759 45.70% 1.40% 9.82% 43.13% NA
All Japonica  1512 61.20% 0.10% 1.06% 37.63% NA
Aus  269 95.90% 0.70% 0.74% 2.60% NA
Indica I  595 35.10% 0.70% 7.90% 56.30% NA
Indica II  465 47.30% 0.60% 5.59% 46.45% NA
Indica III  913 49.10% 2.30% 14.02% 34.61% NA
Indica Intermediate  786 48.70% 1.30% 8.91% 41.09% NA
Temperate Japonica  767 86.20% 0.10% 0.39% 13.30% NA
Tropical Japonica  504 32.30% 0.00% 1.98% 65.67% NA
Japonica Intermediate  241 42.30% 0.00% 1.24% 56.43% NA
VI/Aromatic  96 38.50% 2.10% 4.17% 55.21% NA
Intermediate  90 67.80% 1.10% 2.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204328784 T -> C LOC_Os12g08530.1 upstream_gene_variant ; 3722.0bp to feature; MODIFIER silent_mutation Average:14.072; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1204328784 T -> C LOC_Os12g08540.1 upstream_gene_variant ; 1409.0bp to feature; MODIFIER silent_mutation Average:14.072; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1204328784 T -> C LOC_Os12g08530-LOC_Os12g08540 intergenic_region ; MODIFIER silent_mutation Average:14.072; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1204328784 T -> DEL N N silent_mutation Average:14.072; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204328784 9.92E-07 9.91E-07 mr1848_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204328784 6.01E-08 6.01E-08 mr1848_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251