Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204328784:

Variant ID: vg1204328784 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4328784
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCGACCAGCGATGTAGCATTTCTTCCACTACTTACACTTTAAGTGGTCGAGTTACGACTACTGCCTGGTCCTCGACCAGTGATGTAGCGTTTCTCCCAC[T/C]
ACTTCCACTTCAAGTGGTCGAGTCACGACTACTGCCTGGTCCTCGACCAGCGATGTAGCGTTTCTCCCACTACTTCCACTTTAAGTGGTCGAGTTACGAC

Reverse complement sequence

GTCGTAACTCGACCACTTAAAGTGGAAGTAGTGGGAGAAACGCTACATCGCTGGTCGAGGACCAGGCAGTAGTCGTGACTCGACCACTTGAAGTGGAAGT[A/G]
GTGGGAGAAACGCTACATCACTGGTCGAGGACCAGGCAGTAGTCGTAACTCGACCACTTAAAGTGTAAGTAGTGGAAGAAATGCTACATCGCTGGTCGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	0.90%	6.24%	39.04%	NA
All Indica	2759	45.70%	1.40%	9.82%	43.13%	NA
All Japonica	1512	61.20%	0.10%	1.06%	37.63%	NA
Aus	269	95.90%	0.70%	0.74%	2.60%	NA
Indica I	595	35.10%	0.70%	7.90%	56.30%	NA
Indica II	465	47.30%	0.60%	5.59%	46.45%	NA
Indica III	913	49.10%	2.30%	14.02%	34.61%	NA
Indica Intermediate	786	48.70%	1.30%	8.91%	41.09%	NA
Temperate Japonica	767	86.20%	0.10%	0.39%	13.30%	NA
Tropical Japonica	504	32.30%	0.00%	1.98%	65.67%	NA
Japonica Intermediate	241	42.30%	0.00%	1.24%	56.43%	NA
VI/Aromatic	96	38.50%	2.10%	4.17%	55.21%	NA
Intermediate	90	67.80%	1.10%	2.22%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204328784	T -> C	LOC_Os12g08530.1	upstream_gene_variant ; 3722.0bp to feature; MODIFIER	silent_mutation	Average:14.072; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1204328784	T -> C	LOC_Os12g08540.1	upstream_gene_variant ; 1409.0bp to feature; MODIFIER	silent_mutation	Average:14.072; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1204328784	T -> C	LOC_Os12g08530-LOC_Os12g08540	intergenic_region ; MODIFIER	silent_mutation	Average:14.072; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1204328784	T -> DEL	N	N	silent_mutation	Average:14.072; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204328784	9.92E-07	9.91E-07	mr1848_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204328784	6.01E-08	6.01E-08	mr1848_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251