\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg1204327553:

Variant ID: vg1204327553 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4327553
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTATCGTACCTATTTTTTCAATTTATACAGCATTGTCAGATCAATAATTTATTATGTTTACCCAGAGCATGTTTTTTATACAATATCTGTTGCGCGG[T/G]
TGTCCCCGATGTTAAATCGACTACGATCTAACGCTGGGGGCTCACTCCGTCTTCTTCTGTATAAATCATGCTTGTTTACGGTTGTCCCCGATGTTACATC

Reverse complement sequence

GATGTAACATCGGGGACAACCGTAAACAAGCATGATTTATACAGAAGAAGACGGAGTGAGCCCCCAGCGTTAGATCGTAGTCGATTTAACATCGGGGACA[A/C]
CCGCGCAACAGATATTGTATAAAAAACATGCTCTGGGTAAACATAATAAATTATTGATCTGACAATGCTGTATAAATTGAAAAAATAGGTACGATAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.40% 3.80% 14.03% 54.72% NA
All Indica  2759 8.20% 5.90% 20.66% 65.28% NA
All Japonica  1512 58.30% 0.50% 1.06% 40.21% NA
Aus  269 52.00% 3.30% 13.75% 30.86% NA
Indica I  595 10.60% 4.50% 13.78% 71.09% NA
Indica II  465 8.80% 4.30% 16.99% 69.89% NA
Indica III  913 2.50% 8.70% 26.83% 61.99% NA
Indica Intermediate  786 12.60% 4.60% 20.87% 61.96% NA
Temperate Japonica  767 84.40% 0.10% 0.39% 15.12% NA
Tropical Japonica  504 28.60% 0.60% 1.98% 68.85% NA
Japonica Intermediate  241 37.30% 1.20% 1.24% 60.17% NA
VI/Aromatic  96 18.80% 0.00% 32.29% 48.96% NA
Intermediate  90 35.60% 2.20% 10.00% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204327553 T -> DEL N N silent_mutation Average:12.608; most accessible tissue: Callus, score: 65.639 N N N N
vg1204327553 T -> G LOC_Os12g08530.1 upstream_gene_variant ; 2491.0bp to feature; MODIFIER silent_mutation Average:12.608; most accessible tissue: Callus, score: 65.639 N N N N
vg1204327553 T -> G LOC_Os12g08540.1 upstream_gene_variant ; 2640.0bp to feature; MODIFIER silent_mutation Average:12.608; most accessible tissue: Callus, score: 65.639 N N N N
vg1204327553 T -> G LOC_Os12g08530-LOC_Os12g08540 intergenic_region ; MODIFIER silent_mutation Average:12.608; most accessible tissue: Callus, score: 65.639 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204327553 NA 5.92E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 6.63E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 3.54E-06 NA mr1033_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 7.65E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 3.32E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 2.37E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 6.52E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 2.11E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 6.69E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 9.47E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 2.88E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 6.12E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 2.23E-09 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553 NA 1.18E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251