Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204327553:

Variant ID: vg1204327553 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4327553
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTATCGTACCTATTTTTTCAATTTATACAGCATTGTCAGATCAATAATTTATTATGTTTACCCAGAGCATGTTTTTTATACAATATCTGTTGCGCGG[T/G]
TGTCCCCGATGTTAAATCGACTACGATCTAACGCTGGGGGCTCACTCCGTCTTCTTCTGTATAAATCATGCTTGTTTACGGTTGTCCCCGATGTTACATC

Reverse complement sequence

GATGTAACATCGGGGACAACCGTAAACAAGCATGATTTATACAGAAGAAGACGGAGTGAGCCCCCAGCGTTAGATCGTAGTCGATTTAACATCGGGGACA[A/C]
CCGCGCAACAGATATTGTATAAAAAACATGCTCTGGGTAAACATAATAAATTATTGATCTGACAATGCTGTATAAATTGAAAAAATAGGTACGATAAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.40%	3.80%	14.03%	54.72%	NA
All Indica	2759	8.20%	5.90%	20.66%	65.28%	NA
All Japonica	1512	58.30%	0.50%	1.06%	40.21%	NA
Aus	269	52.00%	3.30%	13.75%	30.86%	NA
Indica I	595	10.60%	4.50%	13.78%	71.09%	NA
Indica II	465	8.80%	4.30%	16.99%	69.89%	NA
Indica III	913	2.50%	8.70%	26.83%	61.99%	NA
Indica Intermediate	786	12.60%	4.60%	20.87%	61.96%	NA
Temperate Japonica	767	84.40%	0.10%	0.39%	15.12%	NA
Tropical Japonica	504	28.60%	0.60%	1.98%	68.85%	NA
Japonica Intermediate	241	37.30%	1.20%	1.24%	60.17%	NA
VI/Aromatic	96	18.80%	0.00%	32.29%	48.96%	NA
Intermediate	90	35.60%	2.20%	10.00%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204327553	T -> DEL	N	N	silent_mutation	Average:12.608; most accessible tissue: Callus, score: 65.639	N	N	N	N
vg1204327553	T -> G	LOC_Os12g08530.1	upstream_gene_variant ; 2491.0bp to feature; MODIFIER	silent_mutation	Average:12.608; most accessible tissue: Callus, score: 65.639	N	N	N	N
vg1204327553	T -> G	LOC_Os12g08540.1	upstream_gene_variant ; 2640.0bp to feature; MODIFIER	silent_mutation	Average:12.608; most accessible tissue: Callus, score: 65.639	N	N	N	N
vg1204327553	T -> G	LOC_Os12g08530-LOC_Os12g08540	intergenic_region ; MODIFIER	silent_mutation	Average:12.608; most accessible tissue: Callus, score: 65.639	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204327553	NA	5.92E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	6.63E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	3.54E-06	NA	mr1033_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	7.65E-06	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	3.32E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	2.37E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	6.52E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	2.11E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	6.69E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	9.47E-09	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	2.88E-15	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	6.12E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	2.23E-09	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204327553	NA	1.18E-21	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251