\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204324619:

Variant ID: vg1204324619 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 4324619
Reference Allele: GCTTTACTAlternative Allele: ACTTTACT,G
Primary Allele: GCTTTACTSecondary Allele: ACTTTACT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACAAAGACTTTTCTTTCCTTCTCTAACTTATGATTCCTGGCCTTCAAGCACATAATTTCTGCATTCTTCACAGCAACCACACCACGAGCATCATCTATC[GCTTTACT/ACTTTACT,G]
CTGTACTTCCACCTTATCCCGACTCTGTTCGACCTCCTTTCGCATCACTTCGTTCTCCCTCCTCAACGAATTCACCCTGTCCCGCAAATCATTCAAGAGC

Reverse complement sequence

GCTCTTGAATGATTTGCGGGACAGGGTGAATTCGTTGAGGAGGGAGAACGAAGTGATGCGAAAGGAGGTCGAACAGAGTCGGGATAAGGTGGAAGTACAG[AGTAAAGC/AGTAAAGT,C]
GATAGATGATGCTCGTGGTGTGGTTGCTGTGAAGAATGCAGAAATTATGTGCTTGAAGGCCAGGAATCATAAGTTAGAGAAGGAAAGAAAAGTCTTTGTA

Allele Frequencies:

Populations Population SizeFrequency of GCTTTACT(primary allele) Frequency of ACTTTACT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.90% 18.10% 0.34% 54.15% G: 2.50%
All Indica  2759 6.50% 30.30% 0.47% 61.00% G: 1.70%
All Japonica  1512 57.90% 0.40% 0.20% 41.47% G: 0.07%
Aus  269 27.10% 0.00% 0.00% 47.96% G: 24.91%
Indica I  595 7.40% 78.30% 0.67% 11.43% G: 2.18%
Indica II  465 8.40% 9.90% 0.65% 80.86% G: 0.22%
Indica III  913 1.90% 15.10% 0.44% 81.27% G: 1.31%
Indica Intermediate  786 10.20% 23.70% 0.25% 63.23% G: 2.67%
Temperate Japonica  767 83.80% 0.50% 0.13% 15.51% NA
Tropical Japonica  504 28.40% 0.20% 0.20% 71.23% NA
Japonica Intermediate  241 36.90% 0.40% 0.41% 61.83% G: 0.41%
VI/Aromatic  96 15.60% 3.10% 0.00% 79.17% G: 2.08%
Intermediate  90 36.70% 13.30% 0.00% 48.89% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204324619 GCTTTACT -> DEL LOC_Os12g08530.1 N frameshift_variant Average:10.753; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg1204324619 GCTTTACT -> G LOC_Os12g08530.1 frameshift_variant ; p.Ser119fs; HIGH frameshift_variant Average:10.753; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg1204324619 GCTTTACT -> ACTTTACT LOC_Os12g08530.1 missense_variant ; p.Ala121Val; MODERATE nonsynonymous_codon ; A121V Average:10.753; most accessible tissue: Zhenshan97 panicle, score: 24.575 benign +0.148 N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204324619 3.21E-06 3.21E-06 mr1053_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 8.70E-07 8.70E-07 mr1058_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 5.14E-06 6.29E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 8.99E-06 NA mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 2.91E-06 NA mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 4.94E-06 4.76E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 2.32E-06 NA mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 3.50E-06 NA mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 8.90E-07 8.90E-07 mr1209_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 3.33E-06 6.90E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 6.73E-06 6.73E-06 mr1351_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 3.54E-06 2.34E-06 mr1415_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 2.45E-07 2.45E-07 mr1424_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 6.29E-07 6.29E-07 mr1500_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 5.02E-06 5.02E-06 mr1571_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 5.37E-06 5.37E-06 mr1605_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 5.32E-06 7.25E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 4.29E-06 4.29E-06 mr1787_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 4.07E-07 4.07E-07 mr1820_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 NA 6.15E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 1.02E-06 5.52E-07 mr1884_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 6.90E-06 6.90E-06 mr1954_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204324619 6.47E-06 6.47E-06 mr1960_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251