\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204323457:

Variant ID: vg1204323457 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4323457
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 42. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGGCAGTTCTGCTCACAGCAAGAAGAGGAAATCTGTCAGCCTAACTACCACAAACACTACAAGCCAATCCAGGACCAAACACTACAAGAGCAAGGTAA[A/C]
TGCAAAAATTTATCCATTCCAAAGTTATCTATTAACCGAAGCAAAGTTTAACATTTAGCACATATATGTTATTGCAGGCACCAATGGAGAGCCAGGAGCT

Reverse complement sequence

AGCTCCTGGCTCTCCATTGGTGCCTGCAATAACATATATGTGCTAAATGTTAAACTTTGCTTCGGTTAATAGATAACTTTGGAATGGATAAATTTTTGCA[T/G]
TTACCTTGCTCTTGTAGTGTTTGGTCCTGGATTGGCTTGTAGTGTTTGTGGTAGTTAGGCTGACAGATTTCCTCTTCTTGCTGTGAGCAGAACTGCCTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.30% 18.40% 0.59% 53.72% NA
All Indica  2759 7.90% 30.80% 0.72% 60.57% NA
All Japonica  1512 58.20% 0.50% 0.26% 41.07% NA
Aus  269 51.70% 0.00% 0.37% 47.96% NA
Indica I  595 9.60% 79.00% 0.50% 10.92% NA
Indica II  465 9.20% 9.70% 1.08% 80.00% NA
Indica III  913 2.50% 15.70% 0.99% 80.83% NA
Indica Intermediate  786 12.20% 24.30% 0.38% 63.10% NA
Temperate Japonica  767 84.10% 0.50% 0.26% 15.12% NA
Tropical Japonica  504 28.80% 0.40% 0.40% 70.44% NA
Japonica Intermediate  241 37.30% 0.40% 0.00% 62.24% NA
VI/Aromatic  96 17.70% 3.10% 0.00% 79.17% NA
Intermediate  90 36.70% 13.30% 3.33% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204323457 A -> C LOC_Os12g08510.1 upstream_gene_variant ; 2709.0bp to feature; MODIFIER silent_mutation Average:13.842; most accessible tissue: Callus, score: 46.57 N N N N
vg1204323457 A -> C LOC_Os12g08530.1 downstream_gene_variant ; 1005.0bp to feature; MODIFIER silent_mutation Average:13.842; most accessible tissue: Callus, score: 46.57 N N N N
vg1204323457 A -> C LOC_Os12g08510-LOC_Os12g08530 intergenic_region ; MODIFIER silent_mutation Average:13.842; most accessible tissue: Callus, score: 46.57 N N N N
vg1204323457 A -> DEL N N silent_mutation Average:13.842; most accessible tissue: Callus, score: 46.57 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204323457 3.75E-06 2.83E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 3.74E-06 2.79E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 3.78E-06 NA mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 7.77E-07 6.62E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 1.04E-06 2.91E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 1.39E-06 NA mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 4.20E-06 9.37E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 8.51E-07 1.40E-06 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 9.99E-06 9.99E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 6.27E-07 8.10E-07 mr1720_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 8.18E-06 6.19E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 NA 4.20E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 3.81E-06 NA mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 5.37E-06 NA mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457 5.35E-06 5.35E-06 mr1960_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251