Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204323457:

Variant ID: vg1204323457 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4323457
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 42. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGGCAGTTCTGCTCACAGCAAGAAGAGGAAATCTGTCAGCCTAACTACCACAAACACTACAAGCCAATCCAGGACCAAACACTACAAGAGCAAGGTAA[A/C]
TGCAAAAATTTATCCATTCCAAAGTTATCTATTAACCGAAGCAAAGTTTAACATTTAGCACATATATGTTATTGCAGGCACCAATGGAGAGCCAGGAGCT

Reverse complement sequence

AGCTCCTGGCTCTCCATTGGTGCCTGCAATAACATATATGTGCTAAATGTTAAACTTTGCTTCGGTTAATAGATAACTTTGGAATGGATAAATTTTTGCA[T/G]
TTACCTTGCTCTTGTAGTGTTTGGTCCTGGATTGGCTTGTAGTGTTTGTGGTAGTTAGGCTGACAGATTTCCTCTTCTTGCTGTGAGCAGAACTGCCTTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.30%	18.40%	0.59%	53.72%	NA
All Indica	2759	7.90%	30.80%	0.72%	60.57%	NA
All Japonica	1512	58.20%	0.50%	0.26%	41.07%	NA
Aus	269	51.70%	0.00%	0.37%	47.96%	NA
Indica I	595	9.60%	79.00%	0.50%	10.92%	NA
Indica II	465	9.20%	9.70%	1.08%	80.00%	NA
Indica III	913	2.50%	15.70%	0.99%	80.83%	NA
Indica Intermediate	786	12.20%	24.30%	0.38%	63.10%	NA
Temperate Japonica	767	84.10%	0.50%	0.26%	15.12%	NA
Tropical Japonica	504	28.80%	0.40%	0.40%	70.44%	NA
Japonica Intermediate	241	37.30%	0.40%	0.00%	62.24%	NA
VI/Aromatic	96	17.70%	3.10%	0.00%	79.17%	NA
Intermediate	90	36.70%	13.30%	3.33%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204323457	A -> C	LOC_Os12g08510.1	upstream_gene_variant ; 2709.0bp to feature; MODIFIER	silent_mutation	Average:13.842; most accessible tissue: Callus, score: 46.57	N	N	N	N
vg1204323457	A -> C	LOC_Os12g08530.1	downstream_gene_variant ; 1005.0bp to feature; MODIFIER	silent_mutation	Average:13.842; most accessible tissue: Callus, score: 46.57	N	N	N	N
vg1204323457	A -> C	LOC_Os12g08510-LOC_Os12g08530	intergenic_region ; MODIFIER	silent_mutation	Average:13.842; most accessible tissue: Callus, score: 46.57	N	N	N	N
vg1204323457	A -> DEL	N	N	silent_mutation	Average:13.842; most accessible tissue: Callus, score: 46.57	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204323457	3.75E-06	2.83E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	3.74E-06	2.79E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	3.78E-06	NA	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	7.77E-07	6.62E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	1.04E-06	2.91E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	1.39E-06	NA	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	4.20E-06	9.37E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	8.51E-07	1.40E-06	mr1247_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	9.99E-06	9.99E-06	mr1424_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	6.27E-07	8.10E-07	mr1720_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	8.18E-06	6.19E-06	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	NA	4.20E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	3.81E-06	NA	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	5.37E-06	NA	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204323457	5.35E-06	5.35E-06	mr1960_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251