\
| Variant ID: vg1204321261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4321261 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATTAAAGCAAGAATAATGTATCAAACAAAGGCCTAACATATTTAGATACAGCAATATCTTGATATAAAGGGCAGATTTAACATATCAATGAGGCATATA[G/A]
AATAAATATAGTTAAATCAGATACGATCGGCTGAAACTCCGATGCTATTCTAATCAGCAACTAGAAGGCAGGCTAGAGATCGATATTCTAAGCACGACTT
AAGTCGTGCTTAGAATATCGATCTCTAGCCTGCCTTCTAGTTGCTGATTAGAATAGCATCGGAGTTTCAGCCGATCGTATCTGATTTAACTATATTTATT[C/T]
TATATGCCTCATTGATATGTTAAATCTGCCCTTTATATCAAGATATTGCTGTATCTAAATATGTTAGGCCTTTGTTTGATACATTATTCTTGCTTTAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.70% | 2.50% | 3.83% | 12.95% | NA |
| All Indica | 2759 | 83.10% | 3.40% | 5.15% | 8.34% | NA |
| All Japonica | 1512 | 72.20% | 1.00% | 2.18% | 24.60% | NA |
| Aus | 269 | 97.40% | 1.90% | 0.37% | 0.37% | NA |
| Indica I | 595 | 79.70% | 3.50% | 8.24% | 8.57% | NA |
| Indica II | 465 | 82.40% | 5.60% | 5.16% | 6.88% | NA |
| Indica III | 913 | 84.00% | 3.10% | 4.16% | 8.76% | NA |
| Indica Intermediate | 786 | 85.20% | 2.30% | 3.94% | 8.52% | NA |
| Temperate Japonica | 767 | 90.20% | 0.10% | 0.52% | 9.13% | NA |
| Tropical Japonica | 504 | 48.00% | 2.80% | 4.56% | 44.64% | NA |
| Japonica Intermediate | 241 | 65.60% | 0.00% | 2.49% | 31.95% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 83.30% | 5.60% | 4.44% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204321261 | G -> DEL | N | N | silent_mutation | Average:7.712; most accessible tissue: Callus, score: 14.394 | N | N | N | N |
| vg1204321261 | G -> A | LOC_Os12g08510.1 | upstream_gene_variant ; 513.0bp to feature; MODIFIER | silent_mutation | Average:7.712; most accessible tissue: Callus, score: 14.394 | N | N | N | N |
| vg1204321261 | G -> A | LOC_Os12g08530.1 | downstream_gene_variant ; 3201.0bp to feature; MODIFIER | silent_mutation | Average:7.712; most accessible tissue: Callus, score: 14.394 | N | N | N | N |
| vg1204321261 | G -> A | LOC_Os12g08510-LOC_Os12g08530 | intergenic_region ; MODIFIER | silent_mutation | Average:7.712; most accessible tissue: Callus, score: 14.394 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204321261 | NA | 5.42E-10 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204321261 | 3.94E-06 | 2.04E-10 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204321261 | 1.00E-06 | 2.55E-12 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204321261 | 7.34E-08 | 2.87E-12 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204321261 | 5.60E-06 | 4.30E-15 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204321261 | 3.76E-09 | 7.91E-16 | mr1191_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |