\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204321261:

Variant ID: vg1204321261 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4321261
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTAAAGCAAGAATAATGTATCAAACAAAGGCCTAACATATTTAGATACAGCAATATCTTGATATAAAGGGCAGATTTAACATATCAATGAGGCATATA[G/A]
AATAAATATAGTTAAATCAGATACGATCGGCTGAAACTCCGATGCTATTCTAATCAGCAACTAGAAGGCAGGCTAGAGATCGATATTCTAAGCACGACTT

Reverse complement sequence

AAGTCGTGCTTAGAATATCGATCTCTAGCCTGCCTTCTAGTTGCTGATTAGAATAGCATCGGAGTTTCAGCCGATCGTATCTGATTTAACTATATTTATT[C/T]
TATATGCCTCATTGATATGTTAAATCTGCCCTTTATATCAAGATATTGCTGTATCTAAATATGTTAGGCCTTTGTTTGATACATTATTCTTGCTTTAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 2.50% 3.83% 12.95% NA
All Indica  2759 83.10% 3.40% 5.15% 8.34% NA
All Japonica  1512 72.20% 1.00% 2.18% 24.60% NA
Aus  269 97.40% 1.90% 0.37% 0.37% NA
Indica I  595 79.70% 3.50% 8.24% 8.57% NA
Indica II  465 82.40% 5.60% 5.16% 6.88% NA
Indica III  913 84.00% 3.10% 4.16% 8.76% NA
Indica Intermediate  786 85.20% 2.30% 3.94% 8.52% NA
Temperate Japonica  767 90.20% 0.10% 0.52% 9.13% NA
Tropical Japonica  504 48.00% 2.80% 4.56% 44.64% NA
Japonica Intermediate  241 65.60% 0.00% 2.49% 31.95% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 83.30% 5.60% 4.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204321261 G -> DEL N N silent_mutation Average:7.712; most accessible tissue: Callus, score: 14.394 N N N N
vg1204321261 G -> A LOC_Os12g08510.1 upstream_gene_variant ; 513.0bp to feature; MODIFIER silent_mutation Average:7.712; most accessible tissue: Callus, score: 14.394 N N N N
vg1204321261 G -> A LOC_Os12g08530.1 downstream_gene_variant ; 3201.0bp to feature; MODIFIER silent_mutation Average:7.712; most accessible tissue: Callus, score: 14.394 N N N N
vg1204321261 G -> A LOC_Os12g08510-LOC_Os12g08530 intergenic_region ; MODIFIER silent_mutation Average:7.712; most accessible tissue: Callus, score: 14.394 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204321261 NA 5.42E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204321261 3.94E-06 2.04E-10 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204321261 1.00E-06 2.55E-12 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204321261 7.34E-08 2.87E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204321261 5.60E-06 4.30E-15 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204321261 3.76E-09 7.91E-16 mr1191_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251