\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204314449:

Variant ID: vg1204314449 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4314449
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAGACCACAATGTTTCGTCCAACCAAGTATGCCATTGCCGAGGATAATCAGAAATTTTCCGCTTAATCAACTTGATCAAACTTTTATTAGACGCCTCGG[C/T]
TTGCCCATTAGCTTGCGCATAATAAGGTGAAGAATTCAACAACTTGATACCCACGCTATCGGCAAACTGAACAAACTCATCGGACACGAAGATTGAACCT

Reverse complement sequence

AGGTTCAATCTTCGTGTCCGATGAGTTTGTTCAGTTTGCCGATAGCGTGGGTATCAAGTTGTTGAATTCTTCACCTTATTATGCGCAAGCTAATGGGCAA[G/A]
CCGAGGCGTCTAATAAAAGTTTGATCAAGTTGATTAAGCGGAAAATTTCTGATTATCCTCGGCAATGGCATACTTGGTTGGACGAAACATTGTGGTCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 8.80% 8.51% 3.11% NA
All Indica  2759 77.40% 11.60% 10.98% 0.00% NA
All Japonica  1512 79.70% 6.00% 4.76% 9.52% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 92.60% 0.80% 6.55% 0.00% NA
Indica II  465 79.40% 11.80% 8.82% 0.00% NA
Indica III  913 63.30% 21.10% 15.55% 0.00% NA
Indica Intermediate  786 81.00% 8.70% 10.31% 0.00% NA
Temperate Japonica  767 90.40% 0.80% 3.78% 5.08% NA
Tropical Japonica  504 78.20% 11.10% 4.76% 5.95% NA
Japonica Intermediate  241 49.00% 12.00% 7.88% 31.12% NA
VI/Aromatic  96 78.10% 0.00% 18.75% 3.12% NA
Intermediate  90 86.70% 4.40% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204314449 C -> DEL LOC_Os12g08510.1 N frameshift_variant Average:9.841; most accessible tissue: Callus, score: 18.783 N N N N
vg1204314449 C -> T LOC_Os12g08510.1 missense_variant ; p.Ala1780Thr; MODERATE nonsynonymous_codon ; A1780T Average:9.841; most accessible tissue: Callus, score: 18.783 possibly damaging 1.937 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204314449 NA 2.26E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1204314449 NA 8.63E-11 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 3.50E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 4.27E-10 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 3.42E-09 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 8.97E-08 7.60E-19 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 7.39E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 2.39E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 1.42E-10 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 7.62E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 5.85E-09 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 2.92E-06 8.55E-21 mr1495 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 1.54E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 1.55E-14 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 8.02E-11 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 3.15E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 2.68E-06 mr1936 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 9.50E-10 1.35E-14 mr1113_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 1.79E-10 1.35E-15 mr1114_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 4.28E-09 4.61E-13 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 2.56E-16 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 2.84E-08 3.20E-12 mr1119_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 8.16E-09 5.98E-15 mr1120_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 4.54E-09 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 7.87E-09 4.62E-14 mr1247_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 1.17E-07 NA mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 7.95E-09 1.50E-10 mr1258_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 3.35E-19 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 6.37E-08 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 3.45E-18 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 1.76E-14 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 1.62E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204314449 NA 4.34E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251