\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204220131:

Variant ID: vg1204220131 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4220131
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCTCTCTCTTCCTCCCCCTCTCTCTCTCTTTCTCTTTCTCTGTTTCTCTCCTTCCTCGTTCTCGCGAGCTTCCCCCAGGTGGCCGACGAGCTCGACCA[A/C]
GTCATTGGCTGCGAGGCGGTCGGAGACCTATGTCTTGAGCTCGCGCCGCCTCGAGCAAAAAGAGTTGGACGAGGAGGCGGCGGCCATGGGCCAGCGTCCA

Reverse complement sequence

TGGACGCTGGCCCATGGCCGCCGCCTCCTCGTCCAACTCTTTTTGCTCGAGGCGGCGCGAGCTCAAGACATAGGTCTCCGACCGCCTCGCAGCCAATGAC[T/G]
TGGTCGAGCTCGTCGGCCACCTGGGGGAAGCTCGCGAGAACGAGGAAGGAGAGAAACAGAGAAAGAGAAAGAGAGAGAGAGGGGGAGGAAGAGAGAGGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 16.00% 0.15% 30.79% NA
All Indica  2759 85.40% 0.80% 0.04% 13.77% NA
All Japonica  1512 2.10% 44.40% 0.20% 53.37% NA
Aus  269 27.50% 13.00% 1.12% 58.36% NA
Indica I  595 91.40% 0.50% 0.00% 8.07% NA
Indica II  465 79.40% 0.40% 0.00% 20.22% NA
Indica III  913 87.00% 0.30% 0.11% 12.60% NA
Indica Intermediate  786 82.40% 1.90% 0.00% 15.65% NA
Temperate Japonica  767 2.00% 71.60% 0.13% 26.34% NA
Tropical Japonica  504 1.80% 16.30% 0.40% 81.55% NA
Japonica Intermediate  241 2.90% 16.60% 0.00% 80.50% NA
VI/Aromatic  96 11.50% 6.20% 0.00% 82.29% NA
Intermediate  90 40.00% 24.40% 0.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204220131 A -> C LOC_Os12g08270.1 upstream_gene_variant ; 3778.0bp to feature; MODIFIER silent_mutation Average:90.419; most accessible tissue: Zhenshan97 flag leaf, score: 95.818 N N N N
vg1204220131 A -> C LOC_Os12g08280.1 upstream_gene_variant ; 647.0bp to feature; MODIFIER silent_mutation Average:90.419; most accessible tissue: Zhenshan97 flag leaf, score: 95.818 N N N N
vg1204220131 A -> C LOC_Os12g08300.1 upstream_gene_variant ; 3754.0bp to feature; MODIFIER silent_mutation Average:90.419; most accessible tissue: Zhenshan97 flag leaf, score: 95.818 N N N N
vg1204220131 A -> C LOC_Os12g08290.1 downstream_gene_variant ; 547.0bp to feature; MODIFIER silent_mutation Average:90.419; most accessible tissue: Zhenshan97 flag leaf, score: 95.818 N N N N
vg1204220131 A -> C LOC_Os12g08280-LOC_Os12g08290 intergenic_region ; MODIFIER silent_mutation Average:90.419; most accessible tissue: Zhenshan97 flag leaf, score: 95.818 N N N N
vg1204220131 A -> DEL N N silent_mutation Average:90.419; most accessible tissue: Zhenshan97 flag leaf, score: 95.818 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1204220131 A C -0.03 -0.03 -0.02 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204220131 2.99E-06 2.99E-06 mr1466 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204220131 7.44E-06 7.43E-06 mr1811 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251