Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204133974:

Variant ID: vg1204133974 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4133974
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

CCGAGCATCCAGGACGAACACGAGGGAAAGGCGTGATTCCCTGGAAGATTGGATTTAAGGAGGACATCCACACGTACAGGAGTCAGATGAGGAGCAAGAG[G/A]
GATACCGAGGCGAAGATTGCAGATCTGGAGTACAGGGTATCGAGCTACGAGCTTAGCATGCAAGAGGAGGTGGCAAGGAAGGTGGATGAACGTATGGCCG

Reverse complement sequence

CGGCCATACGTTCATCCACCTTCCTTGCCACCTCCTCTTGCATGCTAAGCTCGTAGCTCGATACCCTGTACTCCAGATCTGCAATCTTCGCCTCGGTATC[C/T]
CTCTTGCTCCTCATCTGACTCCTGTACGTGTGGATGTCCTCCTTAAATCCAATCTTCCAGGGAATCACGCCTTTCCCTCGTGTTCGTCCTGGATGCTCGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.40%	31.00%	25.07%	3.55%	NA
All Indica	2759	52.10%	13.70%	28.23%	5.98%	NA
All Japonica	1512	27.90%	60.50%	11.44%	0.13%	NA
Aus	269	6.70%	15.20%	77.70%	0.37%	NA
Indica I	595	45.50%	7.90%	36.81%	9.75%	NA
Indica II	465	62.80%	6.50%	23.66%	7.10%	NA
Indica III	913	52.40%	21.90%	22.89%	2.85%	NA
Indica Intermediate	786	50.50%	12.70%	30.66%	6.11%	NA
Temperate Japonica	767	13.00%	81.60%	5.08%	0.26%	NA
Tropical Japonica	504	45.40%	37.50%	17.06%	0.00%	NA
Japonica Intermediate	241	38.60%	41.50%	19.92%	0.00%	NA
VI/Aromatic	96	1.00%	90.60%	8.33%	0.00%	NA
Intermediate	90	34.40%	47.80%	17.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204133974	G -> DEL	LOC_Os12g08110.1	N	frameshift_variant	Average:14.905; most accessible tissue: Callus, score: 32.823	N	N	N	N
vg1204133974	G -> A	LOC_Os12g08110.1	synonymous_variant ; p.Arg363Arg; LOW	synonymous_codon	Average:14.905; most accessible tissue: Callus, score: 32.823	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204133974	NA	5.11E-14	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1204133974	NA	3.38E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	6.49E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	2.56E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	2.20E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	2.99E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	1.48E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	5.50E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	5.15E-24	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	5.52E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	1.55E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	1.18E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	5.65E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	7.43E-10	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	3.18E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	7.30E-06	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	4.25E-12	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	6.03E-08	mr1830_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	2.72E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	6.07E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	1.59E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204133974	NA	1.10E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251