\
| Variant ID: vg1204078883 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4078883 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGCACATGCACGTACACGTACGGATGGACCGATATAGAACGTGGTGCTTTCTAAATATAAATCTATCTATTTGGTATTTTTTAGTTAGATCTAATGGTTA[G/T]
AAAATATGGGTCCCCCAGATTAAATGAAAATCAATGGTTAGATATTTTATTTTTTTCCCAGAATTTCCCTAATTTATTAGAGCGCCACTTGGCGGCCTAG
CTAGGCCGCCAAGTGGCGCTCTAATAAATTAGGGAAATTCTGGGAAAAAAATAAAATATCTAACCATTGATTTTCATTTAATCTGGGGGACCCATATTTT[C/A]
TAACCATTAGATCTAACTAAAAAATACCAAATAGATAGATTTATATTTAGAAAGCACCACGTTCTATATCGGTCCATCCGTACGTGTACGTGCATGTGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 3.20% | 13.73% | 15.98% | NA |
| All Indica | 2759 | 51.50% | 5.30% | 21.02% | 22.15% | NA |
| All Japonica | 1512 | 89.20% | 0.10% | 3.37% | 7.34% | NA |
| Aus | 269 | 86.60% | 1.10% | 4.09% | 8.18% | NA |
| Indica I | 595 | 26.70% | 9.90% | 23.53% | 39.83% | NA |
| Indica II | 465 | 48.20% | 2.80% | 20.22% | 28.82% | NA |
| Indica III | 913 | 69.10% | 3.80% | 18.18% | 8.87% | NA |
| Indica Intermediate | 786 | 51.90% | 5.00% | 22.90% | 20.23% | NA |
| Temperate Japonica | 767 | 95.60% | 0.00% | 1.83% | 2.61% | NA |
| Tropical Japonica | 504 | 86.30% | 0.20% | 2.38% | 11.11% | NA |
| Japonica Intermediate | 241 | 75.10% | 0.00% | 10.37% | 14.52% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 82.20% | 1.10% | 6.67% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204078883 | G -> DEL | N | N | silent_mutation | Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1204078883 | G -> T | LOC_Os12g08020.1 | upstream_gene_variant ; 3360.0bp to feature; MODIFIER | silent_mutation | Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1204078883 | G -> T | LOC_Os12g08030.1 | upstream_gene_variant ; 3335.0bp to feature; MODIFIER | silent_mutation | Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1204078883 | G -> T | LOC_Os12g08025.1 | downstream_gene_variant ; 385.0bp to feature; MODIFIER | silent_mutation | Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1204078883 | G -> T | LOC_Os12g08020-LOC_Os12g08025 | intergenic_region ; MODIFIER | silent_mutation | Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204078883 | 4.80E-06 | NA | mr1645 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |