\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204078883:

Variant ID: vg1204078883 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4078883
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCACATGCACGTACACGTACGGATGGACCGATATAGAACGTGGTGCTTTCTAAATATAAATCTATCTATTTGGTATTTTTTAGTTAGATCTAATGGTTA[G/T]
AAAATATGGGTCCCCCAGATTAAATGAAAATCAATGGTTAGATATTTTATTTTTTTCCCAGAATTTCCCTAATTTATTAGAGCGCCACTTGGCGGCCTAG

Reverse complement sequence

CTAGGCCGCCAAGTGGCGCTCTAATAAATTAGGGAAATTCTGGGAAAAAAATAAAATATCTAACCATTGATTTTCATTTAATCTGGGGGACCCATATTTT[C/A]
TAACCATTAGATCTAACTAAAAAATACCAAATAGATAGATTTATATTTAGAAAGCACCACGTTCTATATCGGTCCATCCGTACGTGTACGTGCATGTGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 3.20% 13.73% 15.98% NA
All Indica  2759 51.50% 5.30% 21.02% 22.15% NA
All Japonica  1512 89.20% 0.10% 3.37% 7.34% NA
Aus  269 86.60% 1.10% 4.09% 8.18% NA
Indica I  595 26.70% 9.90% 23.53% 39.83% NA
Indica II  465 48.20% 2.80% 20.22% 28.82% NA
Indica III  913 69.10% 3.80% 18.18% 8.87% NA
Indica Intermediate  786 51.90% 5.00% 22.90% 20.23% NA
Temperate Japonica  767 95.60% 0.00% 1.83% 2.61% NA
Tropical Japonica  504 86.30% 0.20% 2.38% 11.11% NA
Japonica Intermediate  241 75.10% 0.00% 10.37% 14.52% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 2.08% NA
Intermediate  90 82.20% 1.10% 6.67% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204078883 G -> DEL N N silent_mutation Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1204078883 G -> T LOC_Os12g08020.1 upstream_gene_variant ; 3360.0bp to feature; MODIFIER silent_mutation Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1204078883 G -> T LOC_Os12g08030.1 upstream_gene_variant ; 3335.0bp to feature; MODIFIER silent_mutation Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1204078883 G -> T LOC_Os12g08025.1 downstream_gene_variant ; 385.0bp to feature; MODIFIER silent_mutation Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1204078883 G -> T LOC_Os12g08020-LOC_Os12g08025 intergenic_region ; MODIFIER silent_mutation Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204078883 4.80E-06 NA mr1645 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251