\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204075471:

Variant ID: vg1204075471 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4075471
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, C: 0.29, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


CAGATACCTAAATGAATGAAATAGTATAACAGGATGGTCAAAATTAGAATGAATAGCACAAACAGCAACTGTGAACATTTTGCTTTTTACCTGACCGCTC[C/A]
CAAGAAGGCAGTCTTGCAGAAATGCAGGGAGCTTCCTCAATTGATCCACCATCAAGGAAAGCAGTGGACTCAGCACCAGCATCTATCCAGATAAAAACAT

Reverse complement sequence

ATGTTTTTATCTGGATAGATGCTGGTGCTGAGTCCACTGCTTTCCTTGATGGTGGATCAATTGAGGAAGCTCCCTGCATTTCTGCAAGACTGCCTTCTTG[G/T]
GAGCGGTCAGGTAAAAAGCAAAATGTTCACAGTTGCTGTTTGTGCTATTCATTCTAATTTTGACCATCCTGTTATACTATTTCATTCATTTAGGTATCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.20% 24.50% 1.82% 47.42% NA
All Indica  2759 3.70% 27.60% 2.46% 66.18% NA
All Japonica  1512 59.50% 24.10% 0.07% 16.34% NA
Aus  269 40.10% 3.70% 5.58% 50.56% NA
Indica I  595 3.00% 9.10% 0.67% 87.23% NA
Indica II  465 1.50% 20.00% 9.68% 68.82% NA
Indica III  913 3.40% 43.40% 0.44% 52.79% NA
Indica Intermediate  786 6.00% 27.90% 1.91% 64.25% NA
Temperate Japonica  767 81.00% 13.00% 0.00% 6.00% NA
Tropical Japonica  504 44.00% 37.70% 0.00% 18.25% NA
Japonica Intermediate  241 23.70% 30.70% 0.41% 45.23% NA
VI/Aromatic  96 87.50% 3.10% 2.08% 7.29% NA
Intermediate  90 50.00% 22.20% 0.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204075471 C -> DEL LOC_Os12g08020.1 N frameshift_variant Average:11.976; most accessible tissue: Callus, score: 69.632 N N N N
vg1204075471 C -> A LOC_Os12g08020.1 missense_variant ; p.Gly18Val; MODERATE nonsynonymous_codon ; G18V Average:11.976; most accessible tissue: Callus, score: 69.632 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204075471 NA 1.54E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 2.03E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 1.71E-09 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 2.29E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 3.65E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 8.60E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 2.12E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 1.01E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 2.32E-11 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 1.09E-12 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 6.31E-11 mr1022_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 5.50E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 1.19E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 1.60E-13 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 2.82E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 9.03E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 6.18E-14 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 9.87E-15 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 6.42E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204075471 NA 1.46E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251