\
| Variant ID: vg1204019821 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4019821 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGAGTGACATTTTTGCCCCGCGGAGAGTCGGGGCCAGGGCCCAGCATTTGGGCGAGTGAGAGGCCGGGGGAGACATTCCTCCTGCGGGTGACCCGCAGGG[A/T]
CTCGGGGGTATATTACCCCTCAATATGTAGCCCATTATAGATTTGCAGGCCCAAAAAGCCCATCTAAAAATAGTGGGAATCCAAGGTATATAAGAAAACA
TGTTTTCTTATATACCTTGGATTCCCACTATTTTTAGATGGGCTTTTTGGGCCTGCAAATCTATAATGGGCTACATATTGAGGGGTAATATACCCCCGAG[T/A]
CCCTGCGGGTCACCCGCAGGAGGAATGTCTCCCCCGGCCTCTCACTCGCCCAAATGCTGGGCCCTGGCCCCGACTCTCCGCGGGGCAAAAATGTCACTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.50% | 6.50% | 0.25% | 65.76% | NA |
| All Indica | 2759 | 7.00% | 0.40% | 0.33% | 92.28% | NA |
| All Japonica | 1512 | 62.80% | 19.00% | 0.07% | 18.12% | NA |
| Aus | 269 | 10.00% | 0.00% | 0.74% | 89.22% | NA |
| Indica I | 595 | 1.30% | 0.20% | 0.17% | 98.32% | NA |
| Indica II | 465 | 17.20% | 0.90% | 1.08% | 80.86% | NA |
| Indica III | 913 | 4.40% | 0.10% | 0.00% | 95.51% | NA |
| Indica Intermediate | 786 | 8.10% | 0.80% | 0.38% | 90.71% | NA |
| Temperate Japonica | 767 | 83.30% | 11.90% | 0.13% | 4.69% | NA |
| Tropical Japonica | 504 | 42.30% | 26.40% | 0.00% | 31.35% | NA |
| Japonica Intermediate | 241 | 40.20% | 26.60% | 0.00% | 33.20% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 53.30% | 8.90% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204019821 | A -> DEL | N | N | silent_mutation | Average:12.408; most accessible tissue: Callus, score: 77.042 | N | N | N | N |
| vg1204019821 | A -> T | LOC_Os12g07920.1 | upstream_gene_variant ; 383.0bp to feature; MODIFIER | silent_mutation | Average:12.408; most accessible tissue: Callus, score: 77.042 | N | N | N | N |
| vg1204019821 | A -> T | LOC_Os12g07910.1 | downstream_gene_variant ; 354.0bp to feature; MODIFIER | silent_mutation | Average:12.408; most accessible tissue: Callus, score: 77.042 | N | N | N | N |
| vg1204019821 | A -> T | LOC_Os12g07930.1 | downstream_gene_variant ; 2863.0bp to feature; MODIFIER | silent_mutation | Average:12.408; most accessible tissue: Callus, score: 77.042 | N | N | N | N |
| vg1204019821 | A -> T | LOC_Os12g07910-LOC_Os12g07920 | intergenic_region ; MODIFIER | silent_mutation | Average:12.408; most accessible tissue: Callus, score: 77.042 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204019821 | 1.69E-08 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204019821 | 9.67E-06 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204019821 | 8.97E-06 | NA | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204019821 | 6.00E-06 | NA | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204019821 | NA | 5.06E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204019821 | NA | 7.16E-09 | mr1554 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204019821 | 7.45E-06 | NA | mr1831 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |