\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203908845:

Variant ID: vg1203908845 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3908845
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCAGAGGGTTATTTGTGTGTTTTTGGAAAATTCAGGGTTTAAAGTGCAAAGATTCCAATGCAGAGGAACATGCACTTAATTTCCAAAAACAACAAGGG[T/C]
ATTTTTGCAAAATCACAGGATCCTTTCCCTTTTTTCTTTTTCTTTCCTTTCTTTTCCCCTTCTCTTTCCTTATCTTCTTCTCCCGTTGACCCCGCACATG

Reverse complement sequence

CATGTGCGGGGTCAACGGGAGAAGAAGATAAGGAAAGAGAAGGGGAAAAGAAAGGAAAGAAAAAGAAAAAAGGGAAAGGATCCTGTGATTTTGCAAAAAT[A/G]
CCCTTGTTGTTTTTGGAAATTAAGTGCATGTTCCTCTGCATTGGAATCTTTGCACTTTAAACCCTGAATTTTCCAAAAACACACAAATAACCCTCTGCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.20% 0.70% 3.62% 60.47% NA
All Indica  2759 4.90% 1.00% 3.66% 90.47% NA
All Japonica  1512 90.00% 0.10% 1.59% 8.33% NA
Aus  269 14.10% 1.10% 15.99% 68.77% NA
Indica I  595 2.90% 0.20% 1.68% 95.29% NA
Indica II  465 5.20% 1.10% 3.01% 90.75% NA
Indica III  913 4.80% 1.50% 5.91% 87.73% NA
Indica Intermediate  786 6.20% 1.00% 2.93% 89.82% NA
Temperate Japonica  767 98.60% 0.00% 0.26% 1.17% NA
Tropical Japonica  504 79.40% 0.20% 3.37% 17.06% NA
Japonica Intermediate  241 85.10% 0.00% 2.07% 12.86% NA
VI/Aromatic  96 78.10% 0.00% 0.00% 21.88% NA
Intermediate  90 63.30% 0.00% 3.33% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203908845 T -> C LOC_Os12g07760.1 upstream_gene_variant ; 291.0bp to feature; MODIFIER silent_mutation Average:28.961; most accessible tissue: Callus, score: 75.417 N N N N
vg1203908845 T -> C LOC_Os12g07750-LOC_Os12g07760 intergenic_region ; MODIFIER silent_mutation Average:28.961; most accessible tissue: Callus, score: 75.417 N N N N
vg1203908845 T -> DEL N N silent_mutation Average:28.961; most accessible tissue: Callus, score: 75.417 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203908845 NA 3.68E-26 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 9.04E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 6.17E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 6.57E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 1.99E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 1.67E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 8.79E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 2.70E-17 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 3.47E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 1.21E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 1.25E-12 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 1.13E-34 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 5.36E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 1.86E-06 2.95E-32 mr1414 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 3.27E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 3.58E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 2.97E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 9.18E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 9.11E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203908845 NA 3.27E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251