\
| Variant ID: vg1203908733 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3908733 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 46. )
ACCTGAAATGCAAAGTTGGGGTCGAAATTCAATGTCCCGTGGCTCTTTTATGCGAGAATATGATTTTGGTGATATTTGCAAATTCCGAATGCCATTCAAA[T/C]
AAATATCCCAAATGCAGAGGGTTATTTGTGTGTTTTTGGAAAATTCAGGGTTTAAAGTGCAAAGATTCCAATGCAGAGGAACATGCACTTAATTTCCAAA
TTTGGAAATTAAGTGCATGTTCCTCTGCATTGGAATCTTTGCACTTTAAACCCTGAATTTTCCAAAAACACACAAATAACCCTCTGCATTTGGGATATTT[A/G]
TTTGAATGGCATTCGGAATTTGCAAATATCACCAAAATCATATTCTCGCATAAAAGAGCCACGGGACATTGAATTTCGACCCCAACTTTGCATTTCAGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.00% | 0.20% | 0.25% | 66.57% | NA |
| All Indica | 2759 | 2.20% | 0.30% | 0.33% | 97.21% | NA |
| All Japonica | 1512 | 89.40% | 0.00% | 0.07% | 10.58% | NA |
| Aus | 269 | 7.40% | 0.00% | 0.37% | 92.19% | NA |
| Indica I | 595 | 1.30% | 0.30% | 0.34% | 97.98% | NA |
| Indica II | 465 | 2.40% | 0.20% | 0.43% | 96.99% | NA |
| Indica III | 913 | 1.90% | 0.10% | 0.22% | 97.81% | NA |
| Indica Intermediate | 786 | 3.20% | 0.40% | 0.38% | 96.06% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.13% | 1.17% | NA |
| Tropical Japonica | 504 | 77.80% | 0.00% | 0.00% | 22.22% | NA |
| Japonica Intermediate | 241 | 83.80% | 0.00% | 0.00% | 16.18% | NA |
| VI/Aromatic | 96 | 78.10% | 0.00% | 0.00% | 21.88% | NA |
| Intermediate | 90 | 58.90% | 1.10% | 1.11% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203908733 | T -> C | LOC_Os12g07760.1 | upstream_gene_variant ; 403.0bp to feature; MODIFIER | silent_mutation | Average:28.967; most accessible tissue: Callus, score: 80.476 | N | N | N | N |
| vg1203908733 | T -> C | LOC_Os12g07750-LOC_Os12g07760 | intergenic_region ; MODIFIER | silent_mutation | Average:28.967; most accessible tissue: Callus, score: 80.476 | N | N | N | N |
| vg1203908733 | T -> DEL | N | N | silent_mutation | Average:28.967; most accessible tissue: Callus, score: 80.476 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203908733 | 1.66E-06 | 1.76E-06 | mr1095 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 1.32E-08 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 4.81E-19 | mr1304 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 1.90E-16 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 8.17E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 3.68E-35 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 1.86E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 7.05E-13 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | 4.31E-07 | 5.80E-32 | mr1414 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | 2.88E-06 | 1.92E-06 | mr1414 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 1.55E-07 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 2.94E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 2.22E-06 | mr1682 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 9.60E-08 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203908733 | NA | 6.37E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |