Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1203864713:

Variant ID: vg1203864713 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3864713
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CCTGGGCGAAGCTGAGCCGCACGTCGAGTGACGGAGCGGCACGCTTGAGGAGTTCTCGATGGCCGGCGATCGTCTCCTCCGTGTGGCTCATATGAACCAG[A/G]
GCAATATGGTCTTTCTAACTCTTAACTAACAGCTAAACAGTTCACTGGAATGATGACCACGACGGAAGTGCTATGGGGGGAAGAAAAATCGGTGGCATGT

Reverse complement sequence

ACATGCCACCGATTTTTCTTCCCCCCATAGCACTTCCGTCGTGGTCATCATTCCAGTGAACTGTTTAGCTGTTAGTTAAGAGTTAGAAAGACCATATTGC[T/C]
CTGGTTCATATGAGCCACACGGAGGAGACGATCGCCGGCCATCGAGAACTCCTCAAGCGTGCCGCTCCGTCACTCGACGTGCGGCTCAGCTTCGCCCAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	34.90%	0.02%	0.00%	NA
All Indica	2759	94.20%	5.80%	0.00%	0.00%	NA
All Japonica	1512	10.60%	89.40%	0.07%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	88.40%	11.60%	0.00%	0.00%	NA
Indica III	913	96.20%	3.80%	0.00%	0.00%	NA
Indica Intermediate	786	92.60%	7.40%	0.00%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	22.20%	77.60%	0.20%	0.00%	NA
Japonica Intermediate	241	15.80%	84.20%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203864713	A -> G	LOC_Os12g07680.1	upstream_gene_variant ; 830.0bp to feature; MODIFIER	silent_mutation	Average:77.08; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg1203864713	A -> G	LOC_Os12g07690.1	upstream_gene_variant ; 106.0bp to feature; MODIFIER	silent_mutation	Average:77.08; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg1203864713	A -> G	LOC_Os12g07700.1	upstream_gene_variant ; 3015.0bp to feature; MODIFIER	silent_mutation	Average:77.08; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg1203864713	A -> G	LOC_Os12g07670.1	downstream_gene_variant ; 3668.0bp to feature; MODIFIER	silent_mutation	Average:77.08; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg1203864713	A -> G	LOC_Os12g07690-LOC_Os12g07700	intergenic_region ; MODIFIER	silent_mutation	Average:77.08; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203864713	NA	1.54E-13	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203864713	NA	1.65E-12	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203864713	NA	1.15E-22	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203864713	NA	4.36E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203864713	NA	3.62E-06	mr1864	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203864713	NA	3.79E-15	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203864713	NA	3.75E-14	mr1553_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251