\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203842140:

Variant ID: vg1203842140 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3842140
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATGCATGCTGAATTAATTGAATTAACTCAATCCAAGCTTGAGCTAGGCATCTAGCTAACTTTGTGATTTGATCATGATCAGCTAGCAAAATCATCAT[A/C]
ATCATCATCATCATCATCTCCCTCTTCTCTTAATTTTTGAAAATTAATTAATTGACTGTGCTGATTGATAAGACCATCGTATTAACGTTAATTCGATCGA

Reverse complement sequence

TCGATCGAATTAACGTTAATACGATGGTCTTATCAATCAGCACAGTCAATTAATTAATTTTCAAAAATTAAGAGAAGAGGGAGATGATGATGATGATGAT[T/G]
ATGATGATTTTGCTAGCTGATCATGATCAAATCACAAAGTTAGCTAGATGCCTAGCTCAAGCTTGGATTGAGTTAATTCAATTAATTCAGCATGCATGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 6.70% 18.68% 40.06% NA
All Indica  2759 5.30% 10.20% 22.91% 61.62% NA
All Japonica  1512 88.60% 1.60% 5.09% 4.76% NA
Aus  269 8.90% 0.40% 56.51% 34.20% NA
Indica I  595 4.40% 0.80% 44.37% 50.42% NA
Indica II  465 6.00% 3.90% 16.99% 73.12% NA
Indica III  913 4.10% 16.80% 15.44% 63.75% NA
Indica Intermediate  786 6.90% 13.50% 18.83% 60.81% NA
Temperate Japonica  767 97.10% 1.70% 0.65% 0.52% NA
Tropical Japonica  504 76.20% 1.00% 11.51% 11.31% NA
Japonica Intermediate  241 87.10% 2.50% 5.81% 4.56% NA
VI/Aromatic  96 77.10% 0.00% 14.58% 8.33% NA
Intermediate  90 58.90% 8.90% 8.89% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203842140 A -> C LOC_Os12g07640.1 3_prime_UTR_variant ; 154.0bp to feature; MODIFIER silent_mutation Average:54.328; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg1203842140 A -> DEL N N silent_mutation Average:54.328; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203842140 NA 2.37E-17 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203842140 NA 1.76E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203842140 NA 9.21E-06 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203842140 8.92E-07 8.92E-07 mr1065_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203842140 NA 5.60E-07 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203842140 1.88E-06 1.88E-06 mr1234_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203842140 NA 2.04E-06 mr1718_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251