\
| Variant ID: vg1203799300 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3799300 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 97. )
CAAAGACATTGGCATCGTTCCCCTAGTCTCCTGGAGAAGCTAAGTCACTTATATGATGGGGAATGACGCCAATGATAGGACCTATTTGTAATTTTTTTCT[A/G]
AAAAGAACCTATTTGTGATAAAAAAAACTTATTTGTAATAAAAAATATTTACAAATAAGTCCTCGACACCAATAATACTAGTATTAAAGAGCGGTTTGTA
TACAAACCGCTCTTTAATACTAGTATTATTGGTGTCGAGGACTTATTTGTAAATATTTTTTATTACAAATAAGTTTTTTTTATCACAAATAGGTTCTTTT[T/C]
AGAAAAAAATTACAAATAGGTCCTATCATTGGCGTCATTCCCCATCATATAAGTGACTTAGCTTCTCCAGGAGACTAGGGGAACGATGCCAATGTCTTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 36.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.50% | 89.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 56.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203799300 | A -> G | LOC_Os12g07590.1 | upstream_gene_variant ; 1803.0bp to feature; MODIFIER | silent_mutation | Average:49.955; most accessible tissue: Callus, score: 81.589 | N | N | N | N |
| vg1203799300 | A -> G | LOC_Os12g07590.2 | upstream_gene_variant ; 1803.0bp to feature; MODIFIER | silent_mutation | Average:49.955; most accessible tissue: Callus, score: 81.589 | N | N | N | N |
| vg1203799300 | A -> G | LOC_Os12g07590.3 | upstream_gene_variant ; 1803.0bp to feature; MODIFIER | silent_mutation | Average:49.955; most accessible tissue: Callus, score: 81.589 | N | N | N | N |
| vg1203799300 | A -> G | LOC_Os12g07600.1 | downstream_gene_variant ; 241.0bp to feature; MODIFIER | silent_mutation | Average:49.955; most accessible tissue: Callus, score: 81.589 | N | N | N | N |
| vg1203799300 | A -> G | LOC_Os12g07610.1 | downstream_gene_variant ; 731.0bp to feature; MODIFIER | silent_mutation | Average:49.955; most accessible tissue: Callus, score: 81.589 | N | N | N | N |
| vg1203799300 | A -> G | LOC_Os12g07600-LOC_Os12g07610 | intergenic_region ; MODIFIER | silent_mutation | Average:49.955; most accessible tissue: Callus, score: 81.589 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203799300 | 8.51E-06 | 8.51E-06 | mr1038 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203799300 | NA | 1.44E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203799300 | 4.15E-08 | 4.15E-08 | mr1389 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203799300 | NA | 6.87E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203799300 | NA | 5.52E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203799300 | 9.01E-07 | 9.19E-06 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203799300 | NA | 1.10E-26 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203799300 | NA | 4.07E-33 | mr1256_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203799300 | 5.87E-07 | 5.87E-07 | mr1389_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |