Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203799300:

Variant ID: vg1203799300 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3799300
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAGACATTGGCATCGTTCCCCTAGTCTCCTGGAGAAGCTAAGTCACTTATATGATGGGGAATGACGCCAATGATAGGACCTATTTGTAATTTTTTTCT[A/G]
AAAAGAACCTATTTGTGATAAAAAAAACTTATTTGTAATAAAAAATATTTACAAATAAGTCCTCGACACCAATAATACTAGTATTAAAGAGCGGTTTGTA

Reverse complement sequence

TACAAACCGCTCTTTAATACTAGTATTATTGGTGTCGAGGACTTATTTGTAAATATTTTTTATTACAAATAAGTTTTTTTTATCACAAATAGGTTCTTTT[T/C]
AGAAAAAAATTACAAATAGGTCCTATCATTGGCGTCATTCCCCATCATATAAGTGACTTAGCTTCTCCAGGAGACTAGGGGAACGATGCCAATGTCTTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	36.30%	0.02%	0.00%	NA
All Indica	2759	94.30%	5.70%	0.00%	0.00%	NA
All Japonica	1512	7.10%	92.90%	0.00%	0.00%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	84.10%	15.90%	0.00%	0.00%	NA
Indica III	913	95.20%	4.80%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.80%	0.00%	0.00%	NA
Temperate Japonica	767	3.40%	96.60%	0.00%	0.00%	NA
Tropical Japonica	504	10.50%	89.50%	0.00%	0.00%	NA
Japonica Intermediate	241	11.60%	88.40%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	42.20%	56.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203799300	A -> G	LOC_Os12g07590.1	upstream_gene_variant ; 1803.0bp to feature; MODIFIER	silent_mutation	Average:49.955; most accessible tissue: Callus, score: 81.589	N	N	N	N
vg1203799300	A -> G	LOC_Os12g07590.2	upstream_gene_variant ; 1803.0bp to feature; MODIFIER	silent_mutation	Average:49.955; most accessible tissue: Callus, score: 81.589	N	N	N	N
vg1203799300	A -> G	LOC_Os12g07590.3	upstream_gene_variant ; 1803.0bp to feature; MODIFIER	silent_mutation	Average:49.955; most accessible tissue: Callus, score: 81.589	N	N	N	N
vg1203799300	A -> G	LOC_Os12g07600.1	downstream_gene_variant ; 241.0bp to feature; MODIFIER	silent_mutation	Average:49.955; most accessible tissue: Callus, score: 81.589	N	N	N	N
vg1203799300	A -> G	LOC_Os12g07610.1	downstream_gene_variant ; 731.0bp to feature; MODIFIER	silent_mutation	Average:49.955; most accessible tissue: Callus, score: 81.589	N	N	N	N
vg1203799300	A -> G	LOC_Os12g07600-LOC_Os12g07610	intergenic_region ; MODIFIER	silent_mutation	Average:49.955; most accessible tissue: Callus, score: 81.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203799300	8.51E-06	8.51E-06	mr1038	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300	NA	1.44E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300	4.15E-08	4.15E-08	mr1389	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300	NA	6.87E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300	NA	5.52E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300	9.01E-07	9.19E-06	mr1038_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300	NA	1.10E-26	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300	NA	4.07E-33	mr1256_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300	5.87E-07	5.87E-07	mr1389_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251