\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203799300:

Variant ID: vg1203799300 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3799300
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGACATTGGCATCGTTCCCCTAGTCTCCTGGAGAAGCTAAGTCACTTATATGATGGGGAATGACGCCAATGATAGGACCTATTTGTAATTTTTTTCT[A/G]
AAAAGAACCTATTTGTGATAAAAAAAACTTATTTGTAATAAAAAATATTTACAAATAAGTCCTCGACACCAATAATACTAGTATTAAAGAGCGGTTTGTA

Reverse complement sequence

TACAAACCGCTCTTTAATACTAGTATTATTGGTGTCGAGGACTTATTTGTAAATATTTTTTATTACAAATAAGTTTTTTTTATCACAAATAGGTTCTTTT[T/C]
AGAAAAAAATTACAAATAGGTCCTATCATTGGCGTCATTCCCCATCATATAAGTGACTTAGCTTCTCCAGGAGACTAGGGGAACGATGCCAATGTCTTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.30% 0.02% 0.00% NA
All Indica  2759 94.30% 5.70% 0.00% 0.00% NA
All Japonica  1512 7.10% 92.90% 0.00% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 95.20% 4.80% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 10.50% 89.50% 0.00% 0.00% NA
Japonica Intermediate  241 11.60% 88.40% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203799300 A -> G LOC_Os12g07590.1 upstream_gene_variant ; 1803.0bp to feature; MODIFIER silent_mutation Average:49.955; most accessible tissue: Callus, score: 81.589 N N N N
vg1203799300 A -> G LOC_Os12g07590.2 upstream_gene_variant ; 1803.0bp to feature; MODIFIER silent_mutation Average:49.955; most accessible tissue: Callus, score: 81.589 N N N N
vg1203799300 A -> G LOC_Os12g07590.3 upstream_gene_variant ; 1803.0bp to feature; MODIFIER silent_mutation Average:49.955; most accessible tissue: Callus, score: 81.589 N N N N
vg1203799300 A -> G LOC_Os12g07600.1 downstream_gene_variant ; 241.0bp to feature; MODIFIER silent_mutation Average:49.955; most accessible tissue: Callus, score: 81.589 N N N N
vg1203799300 A -> G LOC_Os12g07610.1 downstream_gene_variant ; 731.0bp to feature; MODIFIER silent_mutation Average:49.955; most accessible tissue: Callus, score: 81.589 N N N N
vg1203799300 A -> G LOC_Os12g07600-LOC_Os12g07610 intergenic_region ; MODIFIER silent_mutation Average:49.955; most accessible tissue: Callus, score: 81.589 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203799300 8.51E-06 8.51E-06 mr1038 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300 NA 1.44E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300 4.15E-08 4.15E-08 mr1389 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300 NA 6.87E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300 NA 5.52E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300 9.01E-07 9.19E-06 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300 NA 1.10E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300 NA 4.07E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203799300 5.87E-07 5.87E-07 mr1389_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251