Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203788125:

Variant ID: vg1203788125 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3788125
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCACCATCTTTCTAGAGGTTGAAGACGTGTGAGCTAGACCCAAGGCTCCACCTGTGGGTTGGGCCAAAGAGAGGTGCCCGAGTGGCGGGAGGTAGCAGA[T/C]
TGGGCTGGGGCTGAAAAAGAAGGGATGAGCTTCCAGCCCAAAACTAAGAAAGTAGTATAACATATACTCCCTCCGTCCTAAAAAAAAAAGACAAACTCTG

Reverse complement sequence

CAGAGTTTGTCTTTTTTTTTTAGGACGGAGGGAGTATATGTTATACTACTTTCTTAGTTTTGGGCTGGAAGCTCATCCCTTCTTTTTCAGCCCCAGCCCA[A/G]
TCTGCTACCTCCCGCCACTCGGGCACCTCTCTTTGGCCCAACCCACAGGTGGAGCCTTGGGTCTAGCTCACACGTCTTCAACCTCTAGAAAGATGGTGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	29.30%	0.99%	0.00%	NA
All Indica	2759	97.60%	2.40%	0.00%	0.00%	NA
All Japonica	1512	19.00%	78.00%	2.98%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	96.40%	3.60%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	2.70%	0.00%	0.00%	NA
Temperate Japonica	767	25.80%	69.00%	5.22%	0.00%	NA
Tropical Japonica	504	10.50%	89.10%	0.40%	0.00%	NA
Japonica Intermediate	241	15.40%	83.40%	1.24%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	42.20%	55.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203788125	T -> C	LOC_Os12g07580.1	upstream_gene_variant ; 1737.0bp to feature; MODIFIER	silent_mutation	Average:71.48; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1203788125	T -> C	LOC_Os12g07590.1	downstream_gene_variant ; 3985.0bp to feature; MODIFIER	silent_mutation	Average:71.48; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1203788125	T -> C	LOC_Os12g07590.2	downstream_gene_variant ; 4276.0bp to feature; MODIFIER	silent_mutation	Average:71.48; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1203788125	T -> C	LOC_Os12g07590.3	downstream_gene_variant ; 4276.0bp to feature; MODIFIER	silent_mutation	Average:71.48; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N
vg1203788125	T -> C	LOC_Os12g07570-LOC_Os12g07580	intergenic_region ; MODIFIER	silent_mutation	Average:71.48; most accessible tissue: Zhenshan97 panicle, score: 87.126	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203788125	NA	9.75E-18	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203788125	NA	3.23E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203788125	4.90E-07	4.90E-07	mr1525	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203788125	NA	2.09E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203788125	NA	3.28E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203788125	NA	1.49E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203788125	NA	9.62E-22	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203788125	NA	7.36E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203788125	NA	4.11E-12	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203788125	NA	2.16E-08	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251