Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203723153:

Variant ID: vg1203723153 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3723153
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATTTTGTAAAAATTAATATGGTATATTATAATGAATATTTAGACCCTTAAATAACCTCAAATAATAAAATAGTCAATATGAAAGTTGTAGATCTCATC[G/T]
AGCTCTACAATGTTGATATAAAGTTTGTCTTCATCTGATTCCGTATGAAAAAGTTATGTATATATACATGTTTTTTCTAAAATTTACTCAATGTCTGCGG

Reverse complement sequence

CCGCAGACATTGAGTAAATTTTAGAAAAAACATGTATATATACATAACTTTTTCATACGGAATCAGATGAAGACAAACTTTATATCAACATTGTAGAGCT[C/A]
GATGAGATCTACAACTTTCATATTGACTATTTTATTATTTGAGGTTATTTAAGGGTCTAAATATTCATTATAATATACCATATTAATTTTTACAAAATCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	3.20%	1.80%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.11%	0.00%	NA
All Japonica	1512	85.10%	9.70%	5.22%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.00%	0.38%	0.00%	NA
Temperate Japonica	767	80.70%	12.10%	7.17%	0.00%	NA
Tropical Japonica	504	92.30%	5.40%	2.38%	0.00%	NA
Japonica Intermediate	241	83.80%	11.20%	4.98%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	1.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203723153	G -> T	LOC_Os12g07490.1	downstream_gene_variant ; 3074.0bp to feature; MODIFIER	silent_mutation	Average:30.63; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1203723153	G -> T	LOC_Os12g07500.1	downstream_gene_variant ; 458.0bp to feature; MODIFIER	silent_mutation	Average:30.63; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1203723153	G -> T	LOC_Os12g07510.1	downstream_gene_variant ; 4689.0bp to feature; MODIFIER	silent_mutation	Average:30.63; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1203723153	G -> T	LOC_Os12g07490-LOC_Os12g07500	intergenic_region ; MODIFIER	silent_mutation	Average:30.63; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203723153	4.40E-06	4.40E-06	mr1520_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203723153	NA	2.85E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251