\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203702115:

Variant ID: vg1203702115 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3702115
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAAGGGGGAAATTTAAAATATTTGCAAATATTAGAATTTAATTATAGGATTAATGAATATAGTTAGATGAATTCTTACTAATTAAATACCAAAAATA[C/T]
TAGCATTTAAATATAGGATTAATGAAAATATAATTGGATGAATTCCTATAGATTATAGATTATTTTTAGTAATCTCCCTAAGAAATCAATTTCGCGGTAA

Reverse complement sequence

TTACCGCGAAATTGATTTCTTAGGGAGATTACTAAAAATAATCTATAATCTATAGGAATTCATCCAATTATATTTTCATTAATCCTATATTTAAATGCTA[G/A]
TATTTTTGGTATTTAATTAGTAAGAATTCATCTAACTATATTCATTAATCCTATAATTAAATTCTAATATTTGCAAATATTTTAAATTTCCCCCTTAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 2.20% 2.73% 18.26% NA
All Indica  2759 68.20% 1.00% 2.10% 28.67% NA
All Japonica  1512 86.40% 5.00% 4.50% 4.10% NA
Aus  269 98.50% 0.00% 0.00% 1.49% NA
Indica I  595 79.80% 1.70% 2.18% 16.30% NA
Indica II  465 58.10% 1.10% 1.72% 39.14% NA
Indica III  913 63.90% 0.00% 1.97% 34.17% NA
Indica Intermediate  786 70.60% 1.50% 2.42% 25.45% NA
Temperate Japonica  767 86.40% 5.50% 7.17% 0.91% NA
Tropical Japonica  504 93.10% 0.20% 0.60% 6.15% NA
Japonica Intermediate  241 72.60% 13.30% 4.15% 9.96% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 0.00% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203702115 C -> DEL N N silent_mutation Average:12.327; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1203702115 C -> T LOC_Os12g07470.1 downstream_gene_variant ; 3028.0bp to feature; MODIFIER silent_mutation Average:12.327; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1203702115 C -> T LOC_Os12g07470-LOC_Os12g07480 intergenic_region ; MODIFIER silent_mutation Average:12.327; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203702115 3.30E-06 NA mr1089_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203702115 4.55E-07 6.41E-06 mr1110_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203702115 9.85E-07 NA mr1112_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203702115 4.15E-06 NA mr1129_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251