| Variant ID: vg1203702115 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3702115 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 82. )
ATTTAAGGGGGAAATTTAAAATATTTGCAAATATTAGAATTTAATTATAGGATTAATGAATATAGTTAGATGAATTCTTACTAATTAAATACCAAAAATA[C/T]
TAGCATTTAAATATAGGATTAATGAAAATATAATTGGATGAATTCCTATAGATTATAGATTATTTTTAGTAATCTCCCTAAGAAATCAATTTCGCGGTAA
TTACCGCGAAATTGATTTCTTAGGGAGATTACTAAAAATAATCTATAATCTATAGGAATTCATCCAATTATATTTTCATTAATCCTATATTTAAATGCTA[G/A]
TATTTTTGGTATTTAATTAGTAAGAATTCATCTAACTATATTCATTAATCCTATAATTAAATTCTAATATTTGCAAATATTTTAAATTTCCCCCTTAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.90% | 2.20% | 2.73% | 18.26% | NA |
| All Indica | 2759 | 68.20% | 1.00% | 2.10% | 28.67% | NA |
| All Japonica | 1512 | 86.40% | 5.00% | 4.50% | 4.10% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 79.80% | 1.70% | 2.18% | 16.30% | NA |
| Indica II | 465 | 58.10% | 1.10% | 1.72% | 39.14% | NA |
| Indica III | 913 | 63.90% | 0.00% | 1.97% | 34.17% | NA |
| Indica Intermediate | 786 | 70.60% | 1.50% | 2.42% | 25.45% | NA |
| Temperate Japonica | 767 | 86.40% | 5.50% | 7.17% | 0.91% | NA |
| Tropical Japonica | 504 | 93.10% | 0.20% | 0.60% | 6.15% | NA |
| Japonica Intermediate | 241 | 72.60% | 13.30% | 4.15% | 9.96% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 0.00% | 3.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203702115 | C -> DEL | N | N | silent_mutation | Average:12.327; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1203702115 | C -> T | LOC_Os12g07470.1 | downstream_gene_variant ; 3028.0bp to feature; MODIFIER | silent_mutation | Average:12.327; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg1203702115 | C -> T | LOC_Os12g07470-LOC_Os12g07480 | intergenic_region ; MODIFIER | silent_mutation | Average:12.327; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203702115 | 3.30E-06 | NA | mr1089_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203702115 | 4.55E-07 | 6.41E-06 | mr1110_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203702115 | 9.85E-07 | NA | mr1112_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203702115 | 4.15E-06 | NA | mr1129_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |