Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1203702115:

Variant ID: vg1203702115 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3702115
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTAAGGGGGAAATTTAAAATATTTGCAAATATTAGAATTTAATTATAGGATTAATGAATATAGTTAGATGAATTCTTACTAATTAAATACCAAAAATA[C/T]
TAGCATTTAAATATAGGATTAATGAAAATATAATTGGATGAATTCCTATAGATTATAGATTATTTTTAGTAATCTCCCTAAGAAATCAATTTCGCGGTAA

Reverse complement sequence

TTACCGCGAAATTGATTTCTTAGGGAGATTACTAAAAATAATCTATAATCTATAGGAATTCATCCAATTATATTTTCATTAATCCTATATTTAAATGCTA[G/A]
TATTTTTGGTATTTAATTAGTAAGAATTCATCTAACTATATTCATTAATCCTATAATTAAATTCTAATATTTGCAAATATTTTAAATTTCCCCCTTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	2.20%	2.73%	18.26%	NA
All Indica	2759	68.20%	1.00%	2.10%	28.67%	NA
All Japonica	1512	86.40%	5.00%	4.50%	4.10%	NA
Aus	269	98.50%	0.00%	0.00%	1.49%	NA
Indica I	595	79.80%	1.70%	2.18%	16.30%	NA
Indica II	465	58.10%	1.10%	1.72%	39.14%	NA
Indica III	913	63.90%	0.00%	1.97%	34.17%	NA
Indica Intermediate	786	70.60%	1.50%	2.42%	25.45%	NA
Temperate Japonica	767	86.40%	5.50%	7.17%	0.91%	NA
Tropical Japonica	504	93.10%	0.20%	0.60%	6.15%	NA
Japonica Intermediate	241	72.60%	13.30%	4.15%	9.96%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	0.00%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203702115	C -> DEL	N	N	silent_mutation	Average:12.327; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1203702115	C -> T	LOC_Os12g07470.1	downstream_gene_variant ; 3028.0bp to feature; MODIFIER	silent_mutation	Average:12.327; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1203702115	C -> T	LOC_Os12g07470-LOC_Os12g07480	intergenic_region ; MODIFIER	silent_mutation	Average:12.327; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203702115	3.30E-06	NA	mr1089_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203702115	4.55E-07	6.41E-06	mr1110_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203702115	9.85E-07	NA	mr1112_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203702115	4.15E-06	NA	mr1129_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251