\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203688153:

Variant ID: vg1203688153 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3688153
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGACGGCGACGATGCACTGGTACCAGAGGTGCCCGGACCTGCGGCGAGCTCTGGGACTCATCGCACACACCGACTCCGGCTTATGCTCCAGAGCATTGTG[T/C]
CAGGGCTGTAGCTATTCCGGCGAGGACTAGACCGGTGGGTGGCGGTGCCGGCGATCGTTCCGGGCAACTTCGTCCTCAACGTCGGCGACCTCTCTTCCAC

Reverse complement sequence

GTGGAAGAGAGGTCGCCGACGTTGAGGACGAAGTTGCCCGGAACGATCGCCGGCACCGCCACCCACCGGTCTAGTCCTCGCCGGAATAGCTACAGCCCTG[A/G]
CACAATGCTCTGGAGCATAAGCCGGAGTCGGTGTGTGCGATGAGTCCCAGAGCTCGCCGCAGGTCCGGGCACCTCTGGTACCAGTGCATCGTCGCCGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 36.10% 1.18% 1.33% NA
All Indica  2759 95.50% 2.90% 0.62% 1.01% NA
All Japonica  1512 1.10% 96.60% 0.26% 2.05% NA
Aus  269 80.30% 13.00% 6.32% 0.37% NA
Indica I  595 96.10% 2.40% 0.84% 0.67% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 95.00% 2.20% 0.55% 2.30% NA
Indica Intermediate  786 94.00% 4.80% 0.76% 0.38% NA
Temperate Japonica  767 1.20% 95.60% 0.13% 3.13% NA
Tropical Japonica  504 0.80% 98.60% 0.20% 0.40% NA
Japonica Intermediate  241 1.70% 95.40% 0.83% 2.07% NA
VI/Aromatic  96 2.10% 84.40% 12.50% 1.04% NA
Intermediate  90 35.60% 55.60% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203688153 T -> C LOC_Os12g07460.1 upstream_gene_variant ; 4624.0bp to feature; MODIFIER silent_mutation Average:24.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1203688153 T -> C LOC_Os12g07460-LOC_Os12g07470 intergenic_region ; MODIFIER silent_mutation Average:24.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg1203688153 T -> DEL N N silent_mutation Average:24.497; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203688153 NA 1.08E-102 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 4.66E-100 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 6.51E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 1.73E-34 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 3.12E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 3.57E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 1.14E-70 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 3.11E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 1.51E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 1.18E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 2.49E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 4.53E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 4.01E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 1.63E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 1.37E-67 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 8.13E-65 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203688153 NA 9.74E-94 mr1907_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251