\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203673794:

Variant ID: vg1203673794 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3673794
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAGGTCCCACAGAAGCAGTTGTGTGTCCTAGGAGCATGAAACAGTGAAAAGTTATGCCAGCGATAGAACATGTAAAAAGAATTGCCAAATAACTTGCC[C/A]
AAATGAATCTCATCACTATAACTAACCATATGAGCAAGAATCGATATTAATAACTAACCAAGTTGATTAACATAAACAGAAAACATTGTCATAGATTGTA

Reverse complement sequence

TACAATCTATGACAATGTTTTCTGTTTATGTTAATCAACTTGGTTAGTTATTAATATCGATTCTTGCTCATATGGTTAGTTATAGTGATGAGATTCATTT[G/T]
GGCAAGTTATTTGGCAATTCTTTTTACATGTTCTATCGCTGGCATAACTTTTCACTGTTTCATGCTCCTAGGACACACAACTGCTTCTGTGGGACCTGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 28.40% 0.02% 0.00% NA
All Indica  2759 96.90% 3.10% 0.00% 0.00% NA
All Japonica  1512 25.20% 74.80% 0.00% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 96.10% 3.90% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 34.90% 65.10% 0.00% 0.00% NA
Tropical Japonica  504 11.10% 88.90% 0.00% 0.00% NA
Japonica Intermediate  241 23.70% 76.30% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203673794 C -> A LOC_Os12g07440.1 downstream_gene_variant ; 3021.0bp to feature; MODIFIER silent_mutation Average:63.89; most accessible tissue: Callus, score: 84.76 N N N N
vg1203673794 C -> A LOC_Os12g07450.1 intron_variant ; MODIFIER silent_mutation Average:63.89; most accessible tissue: Callus, score: 84.76 N N N N
vg1203673794 C -> A LOC_Os12g07450.2 intron_variant ; MODIFIER silent_mutation Average:63.89; most accessible tissue: Callus, score: 84.76 N N N N
vg1203673794 C -> A LOC_Os12g07450.3 intron_variant ; MODIFIER silent_mutation Average:63.89; most accessible tissue: Callus, score: 84.76 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203673794 NA 1.86E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 9.37E-13 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 2.33E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 3.42E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 1.58E-11 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 9.46E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 6.36E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 2.43E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 5.35E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 4.07E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 2.25E-06 NA mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 5.01E-10 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 8.76E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 3.17E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 2.85E-07 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203673794 NA 5.31E-09 mr1548_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251