\
| Variant ID: vg1203660130 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3660130 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTGATGTGTGTGCTCACAATCAATTTTTGGAAGCATTTTCTCCTTGGCCGTGTGTTCTGGAAATTTTCGGAAATTTCGAAAAGGATTTTCGGAAGTTCC[A/G]
AAAATTCACATAACTAAAATTTCACTTCTGGATATTTTTGGAAGTTTCCGAAAATAATTTTCGAAAGTTCCGAAAATTTGCAAAAGGTTGTTTTGGGTTC
GAACCCAAAACAACCTTTTGCAAATTTTCGGAACTTTCGAAAATTATTTTCGGAAACTTCCAAAAATATCCAGAAGTGAAATTTTAGTTATGTGAATTTT[T/C]
GGAACTTCCGAAAATCCTTTTCGAAATTTCCGAAAATTTCCAGAACACACGGCCAAGGAGAAAATGCTTCCAAAAATTGATTGTGAGCACACACATCACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.40% | 9.50% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 79.20% | 20.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 6.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 67.00% | 32.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203660130 | A -> G | LOC_Os12g07420.1 | upstream_gene_variant ; 2001.0bp to feature; MODIFIER | silent_mutation | Average:21.0; most accessible tissue: Zhenshan97 young leaf, score: 31.371 | N | N | N | N |
| vg1203660130 | A -> G | LOC_Os12g07430.1 | upstream_gene_variant ; 4393.0bp to feature; MODIFIER | silent_mutation | Average:21.0; most accessible tissue: Zhenshan97 young leaf, score: 31.371 | N | N | N | N |
| vg1203660130 | A -> G | LOC_Os12g07410.1 | downstream_gene_variant ; 834.0bp to feature; MODIFIER | silent_mutation | Average:21.0; most accessible tissue: Zhenshan97 young leaf, score: 31.371 | N | N | N | N |
| vg1203660130 | A -> G | LOC_Os12g07410-LOC_Os12g07420 | intergenic_region ; MODIFIER | silent_mutation | Average:21.0; most accessible tissue: Zhenshan97 young leaf, score: 31.371 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203660130 | NA | 7.06E-08 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203660130 | NA | 3.75E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203660130 | NA | 5.44E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203660130 | NA | 5.29E-06 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203660130 | 2.09E-06 | 3.94E-11 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203660130 | NA | 2.49E-11 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203660130 | NA | 1.11E-09 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203660130 | NA | 1.77E-08 | mr1282_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |