\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203660130:

Variant ID: vg1203660130 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3660130
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGATGTGTGTGCTCACAATCAATTTTTGGAAGCATTTTCTCCTTGGCCGTGTGTTCTGGAAATTTTCGGAAATTTCGAAAAGGATTTTCGGAAGTTCC[A/G]
AAAATTCACATAACTAAAATTTCACTTCTGGATATTTTTGGAAGTTTCCGAAAATAATTTTCGAAAGTTCCGAAAATTTGCAAAAGGTTGTTTTGGGTTC

Reverse complement sequence

GAACCCAAAACAACCTTTTGCAAATTTTCGGAACTTTCGAAAATTATTTTCGGAAACTTCCAAAAATATCCAGAAGTGAAATTTTAGTTATGTGAATTTT[T/C]
GGAACTTCCGAAAATCCTTTTCGAAATTTCCGAAAATTTCCAGAACACACGGCCAAGGAGAAAATGCTTCCAAAAATTGATTGTGAGCACACACATCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 9.50% 0.06% 0.00% NA
All Indica  2759 95.50% 4.40% 0.04% 0.00% NA
All Japonica  1512 79.20% 20.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.90% 6.90% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 95.60% 4.40% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.10% 0.00% 0.00% NA
Temperate Japonica  767 67.00% 32.90% 0.13% 0.00% NA
Tropical Japonica  504 91.70% 8.30% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203660130 A -> G LOC_Os12g07420.1 upstream_gene_variant ; 2001.0bp to feature; MODIFIER silent_mutation Average:21.0; most accessible tissue: Zhenshan97 young leaf, score: 31.371 N N N N
vg1203660130 A -> G LOC_Os12g07430.1 upstream_gene_variant ; 4393.0bp to feature; MODIFIER silent_mutation Average:21.0; most accessible tissue: Zhenshan97 young leaf, score: 31.371 N N N N
vg1203660130 A -> G LOC_Os12g07410.1 downstream_gene_variant ; 834.0bp to feature; MODIFIER silent_mutation Average:21.0; most accessible tissue: Zhenshan97 young leaf, score: 31.371 N N N N
vg1203660130 A -> G LOC_Os12g07410-LOC_Os12g07420 intergenic_region ; MODIFIER silent_mutation Average:21.0; most accessible tissue: Zhenshan97 young leaf, score: 31.371 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203660130 NA 7.06E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203660130 NA 3.75E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203660130 NA 5.44E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203660130 NA 5.29E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203660130 2.09E-06 3.94E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203660130 NA 2.49E-11 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203660130 NA 1.11E-09 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203660130 NA 1.77E-08 mr1282_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251