\
| Variant ID: vg1203657863 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3657863 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTACATCATATCTTTGGCTTCCTCTTACTTGTGTCCATTCCCTTTCTTGTTTATAGGATGCCACCTCGCAAGTCCATCTCGCGCAGGGGCAAGCGCCTCC[A/G]
GGATCGTTCCCCCACTCCTTCCCCATCCTCCTCGGAGGGCTCGGACAGTGAATGGTCTGGGGAAGGGTACGCGGGGACCGGTCCCCAAGTGACGCAAGTA
TACTTGCGTCACTTGGGGACCGGTCCCCGCGTACCCTTCCCCAGACCATTCACTGTCCGAGCCCTCCGAGGAGGATGGGGAAGGAGTGGGGGAACGATCC[T/C]
GGAGGCGCTTGCCCCTGCGCGAGATGGACTTGCGAGGTGGCATCCTATAAACAAGAAAGGGAATGGACACAAGTAAGAGGAAGCCAAAGATATGATGTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 6.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.70% | 18.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 67.00% | 32.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203657863 | A -> G | LOC_Os12g07410.1 | upstream_gene_variant ; 411.0bp to feature; MODIFIER | silent_mutation | Average:61.27; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg1203657863 | A -> G | LOC_Os12g07420.1 | upstream_gene_variant ; 4268.0bp to feature; MODIFIER | silent_mutation | Average:61.27; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| vg1203657863 | A -> G | LOC_Os12g07400-LOC_Os12g07410 | intergenic_region ; MODIFIER | silent_mutation | Average:61.27; most accessible tissue: Zhenshan97 panicle, score: 77.482 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203657863 | NA | 1.96E-09 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 7.32E-07 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 8.15E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 8.77E-07 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 3.11E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 7.60E-08 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 2.33E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 2.09E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 4.64E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | 3.74E-07 | 1.81E-15 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 3.37E-10 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | 1.25E-06 | 1.63E-16 | mr1182_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 4.93E-09 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | 2.14E-06 | 1.70E-13 | mr1282_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 6.68E-08 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203657863 | NA | 1.36E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |