\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203639038:

Variant ID: vg1203639038 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3639038
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCACCACATTGTCAAATCATGAAATAATTAGGCTTAAAAAATTCGTCTCGCAATTTACACGTAAACTGTGTATTAGTTATTTTTTATCTATATTTAATA[T/C]
TTCATACATGTGTTCAAACGTTCAATGTGACATGCTGTAAAATTTTTGCCAGCATCTAAACAGGGCCTCAGCATCAAGATGAGGGACCTAAAGTGAACTT

Reverse complement sequence

AAGTTCACTTTAGGTCCCTCATCTTGATGCTGAGGCCCTGTTTAGATGCTGGCAAAAATTTTACAGCATGTCACATTGAACGTTTGAACACATGTATGAA[A/G]
TATTAAATATAGATAAAAAATAACTAATACACAGTTTACGTGTAAATTGCGAGACGAATTTTTTAAGCCTAATTATTTCATGATTTGACAATGTGGTGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.30% 17.80% 0.89% 0.00% NA
All Indica  2759 97.60% 1.40% 0.98% 0.00% NA
All Japonica  1512 49.80% 49.40% 0.79% 0.00% NA
Aus  269 90.30% 9.30% 0.37% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 97.00% 0.80% 2.19% 0.00% NA
Indica Intermediate  786 96.20% 3.20% 0.64% 0.00% NA
Temperate Japonica  767 41.20% 57.90% 0.91% 0.00% NA
Tropical Japonica  504 53.00% 46.60% 0.40% 0.00% NA
Japonica Intermediate  241 70.50% 28.20% 1.24% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 70.00% 27.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203639038 T -> C LOC_Os12g07390.1 upstream_gene_variant ; 2651.0bp to feature; MODIFIER silent_mutation Average:80.594; most accessible tissue: Callus, score: 97.469 N N N N
vg1203639038 T -> C LOC_Os12g07360.1 downstream_gene_variant ; 4108.0bp to feature; MODIFIER silent_mutation Average:80.594; most accessible tissue: Callus, score: 97.469 N N N N
vg1203639038 T -> C LOC_Os12g07380.1 downstream_gene_variant ; 1634.0bp to feature; MODIFIER silent_mutation Average:80.594; most accessible tissue: Callus, score: 97.469 N N N N
vg1203639038 T -> C LOC_Os12g07380-LOC_Os12g07390 intergenic_region ; MODIFIER silent_mutation Average:80.594; most accessible tissue: Callus, score: 97.469 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1203639038 T C -0.02 -0.02 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203639038 NA 6.27E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203639038 NA 8.17E-06 mr1940 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203639038 NA 2.15E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203639038 NA 2.55E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203639038 NA 2.10E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203639038 NA 7.00E-07 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203639038 NA 4.32E-07 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203639038 NA 2.31E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203639038 NA 3.72E-06 mr1875_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203639038 4.27E-06 4.27E-06 mr1908_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251