\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203638198:

Variant ID: vg1203638198 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3638198
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.08, C: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AACAAACAAGTATATTATTATAGTAGATTATTATAATCTATAAGCCAGATTATTATAATCTGATAAGCTGCTCTAGAGGAGCTTTTTTCAGATTATTAAG[T/A]
GGCTAAAGACCCACTACCCCTAAATACTTGAGAAAAATTACCCACCTATGCCATCAACCGAACAGATAGCTGAGGACATTATAGACTTTAGCCATTCAAA

Reverse complement sequence

TTTGAATGGCTAAAGTCTATAATGTCCTCAGCTATCTGTTCGGTTGATGGCATAGGTGGGTAATTTTTCTCAAGTATTTAGGGGTAGTGGGTCTTTAGCC[A/T]
CTTAATAATCTGAAAAAAGCTCCTCTAGAGCAGCTTATCAGATTATAATAATCTGGCTTATAGATTATAATAATCTACTATAATAATATACTTGTTTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.10% 17.50% 0.38% 0.00% NA
All Indica  2759 97.80% 2.20% 0.00% 0.00% NA
All Japonica  1512 55.60% 43.30% 1.12% 0.00% NA
Aus  269 97.00% 2.60% 0.37% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.20% 3.80% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 58.10% 40.50% 1.30% 0.00% NA
Tropical Japonica  504 57.50% 41.90% 0.60% 0.00% NA
Japonica Intermediate  241 43.20% 55.20% 1.66% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203638198 T -> A LOC_Os12g07390.1 upstream_gene_variant ; 3491.0bp to feature; MODIFIER silent_mutation Average:33.608; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1203638198 T -> A LOC_Os12g07360.1 downstream_gene_variant ; 3268.0bp to feature; MODIFIER silent_mutation Average:33.608; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1203638198 T -> A LOC_Os12g07380.1 downstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:33.608; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1203638198 T -> A LOC_Os12g07380-LOC_Os12g07390 intergenic_region ; MODIFIER silent_mutation Average:33.608; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203638198 NA 6.43E-06 mr1940 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203638198 NA 7.58E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203638198 NA 5.12E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203638198 NA 4.21E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203638198 NA 6.85E-07 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203638198 NA 2.37E-11 mr1947_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251