Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203635072:

Variant ID: vg1203635072 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3635072
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATGGTTAAGTAAACTCAAAAAATCCTAATTTGTAAAATTTGTAAAAAAAATTAAATTTTGTTGAGGGACCTCCAATGAACTTATTCCTTAATAAATTT[T/C]
GTAAAAATCTTGAAATAAGTCTATTTTTCCTCCCTCAACTCTTGCTCTTGGTTGAATCACATCCCTCAACCTCAAAACCGGGTATAACATGTCCCCCAAC

Reverse complement sequence

GTTGGGGGACATGTTATACCCGGTTTTGAGGTTGAGGGATGTGATTCAACCAAGAGCAAGAGTTGAGGGAGGAAAAATAGACTTATTTCAAGATTTTTAC[A/G]
AAATTTATTAAGGAATAAGTTCATTGGAGGTCCCTCAACAAAATTTAATTTTTTTTACAAATTTTACAAATTAGGATTTTTTGAGTTTACTTAACCATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 17.20% 0.32% 0.00% NA
All Indica  2759 97.90% 2.10% 0.00% 0.00% NA
All Japonica  1512 56.30% 42.70% 0.99% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.20% 3.80% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 58.50% 40.20% 1.30% 0.00% NA
Tropical Japonica  504 58.90% 40.50% 0.60% 0.00% NA
Japonica Intermediate  241 44.00% 55.20% 0.83% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203635072 T -> C LOC_Os12g07370.1 upstream_gene_variant ; 3063.0bp to feature; MODIFIER silent_mutation Average:76.505; most accessible tissue: Zhenshan97 panicle, score: 97.534 N N N N
vg1203635072 T -> C LOC_Os12g07380.1 upstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:76.505; most accessible tissue: Zhenshan97 panicle, score: 97.534 N N N N
vg1203635072 T -> C LOC_Os12g07360.1 downstream_gene_variant ; 142.0bp to feature; MODIFIER silent_mutation Average:76.505; most accessible tissue: Zhenshan97 panicle, score: 97.534 N N N N
vg1203635072 T -> C LOC_Os12g07360-LOC_Os12g07380 intergenic_region ; MODIFIER silent_mutation Average:76.505; most accessible tissue: Zhenshan97 panicle, score: 97.534 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1203635072 T C 0.02 0.02 0.02 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203635072 NA 4.71E-06 mr1940 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 5.45E-06 NA mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 NA 4.12E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 NA 2.07E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 NA 5.79E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 7.91E-06 NA mr1561_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 NA 1.47E-06 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 2.79E-06 NA mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 6.58E-06 NA mr1875_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 8.18E-06 NA mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203635072 NA 5.51E-11 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251