\
| Variant ID: vg1203618566 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3618566 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 99. )
CAGTCCCGTGCTTGTTTTTCATTTTTCATTGTAAATAACTTTTATTTCTCTTAATGAAAAAAAATGCGCTCCTTGCGTATTCCTAAAAAAACAATATTCA[G/A]
AAATTGTTCGACAGGCAGGTACAGCATTTCGTGGTTCAGAAATTCAGAGAAATGGGCTATACCGTTTTGGCGCCAGAAGCTTTCCTGTCATGTTTCATAG
CTATGAAACATGACAGGAAAGCTTCTGGCGCCAAAACGGTATAGCCCATTTCTCTGAATTTCTGAACCACGAAATGCTGTACCTGCCTGTCGAACAATTT[C/T]
TGAATATTGTTTTTTTAGGAATACGCAAGGAGCGCATTTTTTTTCATTAAGAGAAATAAAAGTTATTTACAATGAAAAATGAAAAACAAGCACGGGACTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.80% | 19.00% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 52.80% | 46.80% | 0.40% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.70% | 4.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 58.10% | 41.50% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 52.80% | 46.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.70% | 63.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203618566 | G -> A | LOC_Os12g07350.1 | upstream_gene_variant ; 785.0bp to feature; MODIFIER | silent_mutation | Average:70.879; most accessible tissue: Zhenshan97 flag leaf, score: 89.689 | N | N | N | N |
| vg1203618566 | G -> A | LOC_Os12g07340-LOC_Os12g07350 | intergenic_region ; MODIFIER | silent_mutation | Average:70.879; most accessible tissue: Zhenshan97 flag leaf, score: 89.689 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203618566 | NA | 6.53E-06 | mr1940 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203618566 | 8.19E-06 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203618566 | 6.40E-07 | NA | mr1164_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203618566 | NA | 6.05E-08 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203618566 | NA | 3.87E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203618566 | 8.71E-06 | NA | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203618566 | NA | 2.79E-10 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |