| Variant ID: vg1203617375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3617375 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 222. )
ACCTTTAATATCATGGTTTCCATTTCCACAATGATCCACAGATGAAAAAAAAAGAGCATCTCATATACATGTTGACATTCTATTTGTTTGTAAATGATCT[A/T]
TTGCTCTATTCAAGGATGAAATTATCATTCATAAAAGTACATATTGCCCTTCATATATGACATTTCTTATTCTAAATTCATCTGATGCTTTAGTTCACGA
TCGTGAACTAAAGCATCAGATGAATTTAGAATAAGAAATGTCATATATGAAGGGCAATATGTACTTTTATGAATGATAATTTCATCCTTGAATAGAGCAA[T/A]
AGATCATTTACAAACAAATAGAATGTCAACATGTATATGAGATGCTCTTTTTTTTTCATCTGTGGATCATTGTGGAAATGGAAACCATGATATTAAAGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.20% | 17.40% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 98.10% | 1.40% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 51.40% | 48.30% | 0.26% | 0.00% | NA |
| Aus | 269 | 90.70% | 8.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.90% | 0.80% | 1.31% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 2.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 43.00% | 56.60% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 55.20% | 44.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.10% | 29.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203617375 | A -> T | LOC_Os12g07350.1 | upstream_gene_variant ; 1976.0bp to feature; MODIFIER | silent_mutation | Average:24.475; most accessible tissue: Minghui63 flower, score: 33.997 | N | N | N | N |
| vg1203617375 | A -> T | LOC_Os12g07340.1 | downstream_gene_variant ; 4226.0bp to feature; MODIFIER | silent_mutation | Average:24.475; most accessible tissue: Minghui63 flower, score: 33.997 | N | N | N | N |
| vg1203617375 | A -> T | LOC_Os12g07340-LOC_Os12g07350 | intergenic_region ; MODIFIER | silent_mutation | Average:24.475; most accessible tissue: Minghui63 flower, score: 33.997 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203617375 | NA | 3.29E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203617375 | NA | 3.60E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203617375 | NA | 8.71E-15 | mr1940 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203617375 | NA | 3.33E-06 | mr1940 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203617375 | NA | 6.71E-08 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203617375 | NA | 7.25E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203617375 | 7.89E-06 | 2.26E-08 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203617375 | NA | 2.90E-06 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |