Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203617375:

Variant ID: vg1203617375 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3617375
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

ACCTTTAATATCATGGTTTCCATTTCCACAATGATCCACAGATGAAAAAAAAAGAGCATCTCATATACATGTTGACATTCTATTTGTTTGTAAATGATCT[A/T]
TTGCTCTATTCAAGGATGAAATTATCATTCATAAAAGTACATATTGCCCTTCATATATGACATTTCTTATTCTAAATTCATCTGATGCTTTAGTTCACGA

Reverse complement sequence

TCGTGAACTAAAGCATCAGATGAATTTAGAATAAGAAATGTCATATATGAAGGGCAATATGTACTTTTATGAATGATAATTTCATCCTTGAATAGAGCAA[T/A]
AGATCATTTACAAACAAATAGAATGTCAACATGTATATGAGATGCTCTTTTTTTTTCATCTGTGGATCATTGTGGAAATGGAAACCATGATATTAAAGGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.20%	17.40%	0.44%	0.00%	NA
All Indica	2759	98.10%	1.40%	0.51%	0.00%	NA
All Japonica	1512	51.40%	48.30%	0.26%	0.00%	NA
Aus	269	90.70%	8.20%	1.12%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	97.90%	0.80%	1.31%	0.00%	NA
Indica Intermediate	786	96.80%	2.90%	0.25%	0.00%	NA
Temperate Japonica	767	43.00%	56.60%	0.39%	0.00%	NA
Tropical Japonica	504	55.20%	44.60%	0.20%	0.00%	NA
Japonica Intermediate	241	70.10%	29.90%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203617375	A -> T	LOC_Os12g07350.1	upstream_gene_variant ; 1976.0bp to feature; MODIFIER	silent_mutation	Average:24.475; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N
vg1203617375	A -> T	LOC_Os12g07340.1	downstream_gene_variant ; 4226.0bp to feature; MODIFIER	silent_mutation	Average:24.475; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N
vg1203617375	A -> T	LOC_Os12g07340-LOC_Os12g07350	intergenic_region ; MODIFIER	silent_mutation	Average:24.475; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203617375	NA	3.29E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203617375	NA	3.60E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203617375	NA	8.71E-15	mr1940	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203617375	NA	3.33E-06	mr1940	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203617375	NA	6.71E-08	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203617375	NA	7.25E-06	mr1561_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203617375	7.89E-06	2.26E-08	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203617375	NA	2.90E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251