Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203607472:

Variant ID: vg1203607472 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3607472
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCCTCCTCTTTCGTCTTCTTGTCCTTGCCGTTGTGGTCTCTTCCACCCATGTTGCTACCTACTCCCGCCGTCTCATTAAAAACGAATCTAGAATCTGAT[G/A]
TGATATATTTTAGTACGATGAATTTGAATATATGTATGTCCAGATTCGTAGTACTAAAATATGTCACATCTGATATTAGGTTGGTTTTTTATGGGACGGA

Reverse complement sequence

TCCGTCCCATAAAAAACCAACCTAATATCAGATGTGACATATTTTAGTACTACGAATCTGGACATACATATATTCAAATTCATCGTACTAAAATATATCA[C/T]
ATCAGATTCTAGATTCGTTTTTAATGAGACGGCGGGAGTAGGTAGCAACATGGGTGGAAGAGACCACAACGGCAAGGACAAGAAGACGAAAGAGGAGGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.20%	16.70%	0.74%	0.28%	NA
All Indica	2759	97.50%	1.80%	0.29%	0.43%	NA
All Japonica	1512	56.30%	41.90%	1.79%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.70%	0.00%	0.50%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	95.80%	2.80%	0.44%	0.88%	NA
Indica Intermediate	786	97.50%	2.00%	0.38%	0.13%	NA
Temperate Japonica	767	65.70%	31.00%	3.26%	0.00%	NA
Tropical Japonica	504	35.30%	64.70%	0.00%	0.00%	NA
Japonica Intermediate	241	70.50%	28.60%	0.83%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	70.00%	28.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203607472	G -> DEL	N	N	silent_mutation	Average:61.147; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg1203607472	G -> A	LOC_Os12g07340.1	upstream_gene_variant ; 3886.0bp to feature; MODIFIER	silent_mutation	Average:61.147; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg1203607472	G -> A	LOC_Os12g07310.1	downstream_gene_variant ; 2431.0bp to feature; MODIFIER	silent_mutation	Average:61.147; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg1203607472	G -> A	LOC_Os12g07310-LOC_Os12g07340	intergenic_region ; MODIFIER	silent_mutation	Average:61.147; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203607472	NA	6.77E-15	mr1070	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	7.91E-06	mr1070	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	7.27E-07	mr1092	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	2.09E-14	mr1097	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	1.96E-07	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	2.64E-14	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	4.55E-06	mr1149	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	9.73E-06	mr1154	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	2.99E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	5.15E-07	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	3.12E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	4.41E-14	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	6.81E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	7.19E-14	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	3.26E-06	mr1154_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	8.43E-07	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	3.73E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	2.22E-13	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472	NA	9.28E-06	mr1745_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251