\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203607472:

Variant ID: vg1203607472 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3607472
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCTCCTCTTTCGTCTTCTTGTCCTTGCCGTTGTGGTCTCTTCCACCCATGTTGCTACCTACTCCCGCCGTCTCATTAAAAACGAATCTAGAATCTGAT[G/A]
TGATATATTTTAGTACGATGAATTTGAATATATGTATGTCCAGATTCGTAGTACTAAAATATGTCACATCTGATATTAGGTTGGTTTTTTATGGGACGGA

Reverse complement sequence

TCCGTCCCATAAAAAACCAACCTAATATCAGATGTGACATATTTTAGTACTACGAATCTGGACATACATATATTCAAATTCATCGTACTAAAATATATCA[C/T]
ATCAGATTCTAGATTCGTTTTTAATGAGACGGCGGGAGTAGGTAGCAACATGGGTGGAAGAGACCACAACGGCAAGGACAAGAAGACGAAAGAGGAGGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.20% 16.70% 0.74% 0.28% NA
All Indica  2759 97.50% 1.80% 0.29% 0.43% NA
All Japonica  1512 56.30% 41.90% 1.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.70% 0.00% 0.50% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 95.80% 2.80% 0.44% 0.88% NA
Indica Intermediate  786 97.50% 2.00% 0.38% 0.13% NA
Temperate Japonica  767 65.70% 31.00% 3.26% 0.00% NA
Tropical Japonica  504 35.30% 64.70% 0.00% 0.00% NA
Japonica Intermediate  241 70.50% 28.60% 0.83% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203607472 G -> DEL N N silent_mutation Average:61.147; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1203607472 G -> A LOC_Os12g07340.1 upstream_gene_variant ; 3886.0bp to feature; MODIFIER silent_mutation Average:61.147; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1203607472 G -> A LOC_Os12g07310.1 downstream_gene_variant ; 2431.0bp to feature; MODIFIER silent_mutation Average:61.147; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1203607472 G -> A LOC_Os12g07310-LOC_Os12g07340 intergenic_region ; MODIFIER silent_mutation Average:61.147; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203607472 NA 6.77E-15 mr1070 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 7.91E-06 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 7.27E-07 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 2.09E-14 mr1097 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 1.96E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 2.64E-14 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 4.55E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 9.73E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 2.99E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 5.15E-07 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 3.12E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 4.41E-14 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 6.81E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 7.19E-14 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 3.26E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 8.43E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 3.73E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 2.22E-13 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203607472 NA 9.28E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251