\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203606348:

Variant ID: vg1203606348 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3606348
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTATTAAAAACGTTGTCTGTAGTGCTTACTCTAGTTGAGTTGGAGATTTTTATAGTAGGCAATCGGCTATATTATTGTCGTTGCCCTTAGAAAGTTCA[G/A]
ACATGATCTATTAAATGTCGAGCATATCAAGGGATTAAATTGATACCTCATACTACTAGTAATAGGCCAGTACGTAGCTTTGCATCAAATCTAAAATCAC

Reverse complement sequence

GTGATTTTAGATTTGATGCAAAGCTACGTACTGGCCTATTACTAGTAGTATGAGGTATCAATTTAATCCCTTGATATGCTCGACATTTAATAGATCATGT[C/T]
TGAACTTTCTAAGGGCAACGACAATAATATAGCCGATTGCCTACTATAAAAATCTCCAACTCAACTAGAGTAAGCACTACAGACAACGTTTTTAATAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.20% 17.20% 0.61% 0.00% NA
All Indica  2759 97.50% 2.40% 0.11% 0.00% NA
All Japonica  1512 56.20% 42.10% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 95.80% 4.10% 0.11% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 65.60% 31.40% 3.00% 0.00% NA
Tropical Japonica  504 35.10% 64.70% 0.20% 0.00% NA
Japonica Intermediate  241 70.50% 28.60% 0.83% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203606348 G -> A LOC_Os12g07310.1 downstream_gene_variant ; 1307.0bp to feature; MODIFIER silent_mutation Average:66.901; most accessible tissue: Minghui63 root, score: 89.472 N N N N
vg1203606348 G -> A LOC_Os12g07310-LOC_Os12g07340 intergenic_region ; MODIFIER silent_mutation Average:66.901; most accessible tissue: Minghui63 root, score: 89.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203606348 NA 9.70E-15 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 7.91E-06 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 7.27E-07 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 6.61E-14 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 1.96E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 2.01E-14 mr1128 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 4.55E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 9.73E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 4.80E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 7.87E-07 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 3.12E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 6.22E-14 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 6.81E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 3.77E-14 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 3.26E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 8.43E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 4.83E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 2.22E-13 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203606348 NA 9.28E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251