Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203587545:

Variant ID: vg1203587545 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3587545
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGTAGAGTTCCAGAGTGCAGAGAACTTTAGTCTGCACAGCTAAATTCGTTCATGCAAGGCAAGATGGACTGTGTTGTGGTATTGGAGTTTGTTTGTTCT[G/T]
GTTAAGAATTGTATGAGTTCGATTAGGGCTCCTTTTCAGTGTCGGTATGCATTAGATTATTACTCCCTCCGTTTCATCATGAGTTCGGCACCATAAGTTA

Reverse complement sequence

TAACTTATGGTGCCGAACTCATGATGAAACGGAGGGAGTAATAATCTAATGCATACCGACACTGAAAAGGAGCCCTAATCGAACTCATACAATTCTTAAC[C/A]
AGAACAAACAAACTCCAATACCACAACACAGTCCATCTTGCCTTGCATGAACGAATTTAGCTGTGCAGACTAAAGTTCTCTGCACTCTGGAACTCTACTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	37.70%	0.02%	0.00%	NA
All Indica	2759	95.10%	4.90%	0.04%	0.00%	NA
All Japonica	1512	4.00%	96.00%	0.00%	0.00%	NA
Aus	269	82.50%	17.50%	0.00%	0.00%	NA
Indica I	595	97.50%	2.40%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	93.40%	6.60%	0.00%	0.00%	NA
Indica Intermediate	786	93.30%	6.70%	0.00%	0.00%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	8.10%	91.90%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	35.60%	64.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203587545	G -> T	LOC_Os12g07300.1	upstream_gene_variant ; 3597.0bp to feature; MODIFIER	silent_mutation	Average:54.105; most accessible tissue: Callus, score: 83.328	N	N	N	N
vg1203587545	G -> T	LOC_Os12g07300.2	upstream_gene_variant ; 3597.0bp to feature; MODIFIER	silent_mutation	Average:54.105; most accessible tissue: Callus, score: 83.328	N	N	N	N
vg1203587545	G -> T	LOC_Os12g07280.1	downstream_gene_variant ; 4571.0bp to feature; MODIFIER	silent_mutation	Average:54.105; most accessible tissue: Callus, score: 83.328	N	N	N	N
vg1203587545	G -> T	LOC_Os12g07290.1	downstream_gene_variant ; 159.0bp to feature; MODIFIER	silent_mutation	Average:54.105; most accessible tissue: Callus, score: 83.328	N	N	N	N
vg1203587545	G -> T	LOC_Os12g07290.2	downstream_gene_variant ; 163.0bp to feature; MODIFIER	silent_mutation	Average:54.105; most accessible tissue: Callus, score: 83.328	N	N	N	N
vg1203587545	G -> T	LOC_Os12g07290-LOC_Os12g07300	intergenic_region ; MODIFIER	silent_mutation	Average:54.105; most accessible tissue: Callus, score: 83.328	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203587545	NA	9.18E-20	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1203587545	NA	3.99E-36	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	4.74E-28	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	5.51E-29	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	1.20E-39	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	9.87E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	5.74E-41	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	1.22E-29	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	3.19E-54	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	3.82E-06	NA	mr1817	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	1.33E-54	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	3.48E-69	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	8.62E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	3.31E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545	NA	4.44E-15	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251