\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203587545:

Variant ID: vg1203587545 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3587545
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTAGAGTTCCAGAGTGCAGAGAACTTTAGTCTGCACAGCTAAATTCGTTCATGCAAGGCAAGATGGACTGTGTTGTGGTATTGGAGTTTGTTTGTTCT[G/T]
GTTAAGAATTGTATGAGTTCGATTAGGGCTCCTTTTCAGTGTCGGTATGCATTAGATTATTACTCCCTCCGTTTCATCATGAGTTCGGCACCATAAGTTA

Reverse complement sequence

TAACTTATGGTGCCGAACTCATGATGAAACGGAGGGAGTAATAATCTAATGCATACCGACACTGAAAAGGAGCCCTAATCGAACTCATACAATTCTTAAC[C/A]
AGAACAAACAAACTCCAATACCACAACACAGTCCATCTTGCCTTGCATGAACGAATTTAGCTGTGCAGACTAAAGTTCTCTGCACTCTGGAACTCTACTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.70% 0.02% 0.00% NA
All Indica  2759 95.10% 4.90% 0.04% 0.00% NA
All Japonica  1512 4.00% 96.00% 0.00% 0.00% NA
Aus  269 82.50% 17.50% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 93.40% 6.60% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.70% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 8.10% 91.90% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 35.60% 64.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203587545 G -> T LOC_Os12g07300.1 upstream_gene_variant ; 3597.0bp to feature; MODIFIER silent_mutation Average:54.105; most accessible tissue: Callus, score: 83.328 N N N N
vg1203587545 G -> T LOC_Os12g07300.2 upstream_gene_variant ; 3597.0bp to feature; MODIFIER silent_mutation Average:54.105; most accessible tissue: Callus, score: 83.328 N N N N
vg1203587545 G -> T LOC_Os12g07280.1 downstream_gene_variant ; 4571.0bp to feature; MODIFIER silent_mutation Average:54.105; most accessible tissue: Callus, score: 83.328 N N N N
vg1203587545 G -> T LOC_Os12g07290.1 downstream_gene_variant ; 159.0bp to feature; MODIFIER silent_mutation Average:54.105; most accessible tissue: Callus, score: 83.328 N N N N
vg1203587545 G -> T LOC_Os12g07290.2 downstream_gene_variant ; 163.0bp to feature; MODIFIER silent_mutation Average:54.105; most accessible tissue: Callus, score: 83.328 N N N N
vg1203587545 G -> T LOC_Os12g07290-LOC_Os12g07300 intergenic_region ; MODIFIER silent_mutation Average:54.105; most accessible tissue: Callus, score: 83.328 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203587545 NA 9.18E-20 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1203587545 NA 3.99E-36 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 4.74E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 5.51E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 1.20E-39 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 9.87E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 5.74E-41 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 1.22E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 3.19E-54 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 3.82E-06 NA mr1817 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 1.33E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 3.48E-69 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 8.62E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 3.31E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203587545 NA 4.44E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251