| Variant ID: vg1203449282 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3449282 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAAACCTAATTAATCCATCATTAGCACATGTGGGTTACTGTAGTACTTATGGCTAATCATGGACTAATTAGGCTCAAAAGATTCGTCTCACGATTTTCC[C/A]
CCTAACTGTGCAATTAGTTTTTTATTTTATCTATATTTAATGCTACATGCATGTATCCAAAATTTTAATGTAGCGTTTTTTTAAAAAAAATAGGGACTAA
TTAGTCCCTATTTTTTTTAAAAAAACGCTACATTAAAATTTTGGATACATGCATGTAGCATTAAATATAGATAAAATAAAAAACTAATTGCACAGTTAGG[G/T]
GGAAAATCGTGAGACGAATCTTTTGAGCCTAATTAGTCCATGATTAGCCATAAGTACTACAGTAACCCACATGTGCTAATGATGGATTAATTAGGTTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 4.50% | 0.91% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 83.50% | 14.00% | 2.51% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 72.10% | 23.20% | 4.69% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 12.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 2.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203449282 | C -> A | LOC_Os12g07050.1 | downstream_gene_variant ; 784.0bp to feature; MODIFIER | silent_mutation | Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1203449282 | C -> A | LOC_Os12g07050.3 | downstream_gene_variant ; 784.0bp to feature; MODIFIER | silent_mutation | Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1203449282 | C -> A | LOC_Os12g07050.2 | downstream_gene_variant ; 3547.0bp to feature; MODIFIER | silent_mutation | Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1203449282 | C -> A | LOC_Os12g07030-LOC_Os12g07050 | intergenic_region ; MODIFIER | silent_mutation | Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203449282 | NA | 1.12E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203449282 | NA | 4.63E-06 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203449282 | NA | 2.63E-06 | mr1221_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203449282 | 8.27E-06 | NA | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203449282 | NA | 6.04E-07 | mr1296_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203449282 | NA | 6.67E-07 | mr1358_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203449282 | 4.58E-06 | 4.58E-06 | mr1474_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203449282 | 1.90E-06 | NA | mr1748_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203449282 | NA | 7.23E-06 | mr1748_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203449282 | NA | 4.52E-06 | mr1761_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |