Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1203449282:

Variant ID: vg1203449282 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3449282
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAAACCTAATTAATCCATCATTAGCACATGTGGGTTACTGTAGTACTTATGGCTAATCATGGACTAATTAGGCTCAAAAGATTCGTCTCACGATTTTCC[C/A]
CCTAACTGTGCAATTAGTTTTTTATTTTATCTATATTTAATGCTACATGCATGTATCCAAAATTTTAATGTAGCGTTTTTTTAAAAAAAATAGGGACTAA

Reverse complement sequence

TTAGTCCCTATTTTTTTTAAAAAAACGCTACATTAAAATTTTGGATACATGCATGTAGCATTAAATATAGATAAAATAAAAAACTAATTGCACAGTTAGG[G/T]
GGAAAATCGTGAGACGAATCTTTTGAGCCTAATTAGTCCATGATTAGCCATAAGTACTACAGTAACCCACATGTGCTAATGATGGATTAATTAGGTTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	4.50%	0.91%	0.00%	NA
All Indica	2759	99.80%	0.10%	0.11%	0.00%	NA
All Japonica	1512	83.50%	14.00%	2.51%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.00%	0.25%	0.00%	NA
Temperate Japonica	767	72.10%	23.20%	4.69%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	86.70%	12.90%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	2.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203449282	C -> A	LOC_Os12g07050.1	downstream_gene_variant ; 784.0bp to feature; MODIFIER	silent_mutation	Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1203449282	C -> A	LOC_Os12g07050.3	downstream_gene_variant ; 784.0bp to feature; MODIFIER	silent_mutation	Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1203449282	C -> A	LOC_Os12g07050.2	downstream_gene_variant ; 3547.0bp to feature; MODIFIER	silent_mutation	Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg1203449282	C -> A	LOC_Os12g07030-LOC_Os12g07050	intergenic_region ; MODIFIER	silent_mutation	Average:64.027; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203449282	NA	1.12E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282	NA	4.63E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282	NA	2.63E-06	mr1221_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282	8.27E-06	NA	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282	NA	6.04E-07	mr1296_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282	NA	6.67E-07	mr1358_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282	4.58E-06	4.58E-06	mr1474_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282	1.90E-06	NA	mr1748_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282	NA	7.23E-06	mr1748_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203449282	NA	4.52E-06	mr1761_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251