Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203437431:

Variant ID: vg1203437431 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3437431
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TACATTCATCATGAGACACAAGCCATGTCATAGCCATGTTTTGAGCCAATTCAGAGAAATTTTACAGGAATTTTGGATGCCCATTCCTTTCATATAAGAA[A/T]
TTTTTTTTCATAGGATTGGGTTTCTTCAAAAATCTTTTGTTCTATAAAACCAGAAAAAGAAAATCTTCAGACTGCACTAGTTTCATTCGTACAAGCTTGA

Reverse complement sequence

TCAAGCTTGTACGAATGAAACTAGTGCAGTCTGAAGATTTTCTTTTTCTGGTTTTATAGAACAAAAGATTTTTGAAGAAACCCAATCCTATGAAAAAAAA[T/A]
TTCTTATATGAAAGGAATGGGCATCCAAAATTCCTGTAAAATTTCTCTGAATTGGCTCAAAACATGGCTATGACATGGCTTGTGTCTCATGATGAATGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.60% 6.90% 1.44% 0.00% NA
All Indica  2759 95.80% 4.00% 0.18% 0.00% NA
All Japonica  1512 82.20% 14.00% 3.84% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.90% 5.90% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 96.50% 3.30% 0.22% 0.00% NA
Indica Intermediate  786 94.80% 5.00% 0.25% 0.00% NA
Temperate Japonica  767 70.10% 22.90% 6.91% 0.00% NA
Tropical Japonica  504 99.00% 0.60% 0.40% 0.00% NA
Japonica Intermediate  241 85.50% 13.30% 1.24% 0.00% NA
VI/Aromatic  96 92.70% 5.20% 2.08% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203437431 A -> T LOC_Os12g07030.1 3_prime_UTR_variant ; 674.0bp to feature; MODIFIER silent_mutation Average:91.387; most accessible tissue: Zhenshan97 flag leaf, score: 97.084 N N N N
vg1203437431 A -> T LOC_Os12g07020.1 downstream_gene_variant ; 207.0bp to feature; MODIFIER silent_mutation Average:91.387; most accessible tissue: Zhenshan97 flag leaf, score: 97.084 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1203437431 A T 0.0 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203437431 7.81E-06 NA Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1203437431 NA 1.03E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 9.99E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 3.21E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 6.00E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 1.26E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 6.05E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 6.30E-06 6.29E-06 mr1081_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 9.43E-07 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 2.79E-06 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 6.47E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 1.76E-07 mr1296_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 1.35E-07 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 5.10E-06 mr1381_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 6.54E-06 mr1381_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 8.66E-07 8.66E-07 mr1474_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 8.78E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203437431 NA 6.72E-06 mr1761_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251