\
| Variant ID: vg1203260505 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3260505 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGGAGTCTACTCTTTTCGCCCATTTGTTCGTGTCTTAACCTTGCGCTTTTCCATTTACCTTTCTAGTGCTGATTTTAGCAGGGTATTCGCTATCATGCCT[A/G]
GAAATTCACAAACCAGAATTTCTAAGCTGAATGTGCATTAAACCCCTGTCCAGGACCAGCCAGGGTACACAAATGACAATTGTTGTCATACAGACCCACG
CGTGGGTCTGTATGACAACAATTGTCATTTGTGTACCCTGGCTGGTCCTGGACAGGGGTTTAATGCACATTCAGCTTAGAAATTCTGGTTTGTGAATTTC[T/C]
AGGCATGATAGCGAATACCCTGCTAAAATCAGCACTAGAAAGGTAAATGGAAAAGCGCAAGGTTAAGACACGAACAAATGGGCGAAAAGAGTAGACTCCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 35.20% | 0.04% | 0.08% | NA |
| All Indica | 2759 | 95.60% | 4.20% | 0.07% | 0.14% | NA |
| All Japonica | 1512 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.80% | 0.00% | 0.17% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.80% | 7.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 95.30% | 4.30% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 58.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203260505 | A -> DEL | N | N | silent_mutation | Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg1203260505 | A -> G | LOC_Os12g06680.1 | upstream_gene_variant ; 4435.0bp to feature; MODIFIER | silent_mutation | Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg1203260505 | A -> G | LOC_Os12g06700.1 | upstream_gene_variant ; 1592.0bp to feature; MODIFIER | silent_mutation | Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg1203260505 | A -> G | LOC_Os12g06710.1 | downstream_gene_variant ; 4336.0bp to feature; MODIFIER | silent_mutation | Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg1203260505 | A -> G | LOC_Os12g06690.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203260505 | NA | 1.85E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203260505 | 4.21E-06 | NA | mr1011 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203260505 | NA | 7.89E-35 | mr1105 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203260505 | NA | 7.02E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203260505 | NA | 7.02E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203260505 | NA | 9.45E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |