\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203260505:

Variant ID: vg1203260505 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3260505
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGAGTCTACTCTTTTCGCCCATTTGTTCGTGTCTTAACCTTGCGCTTTTCCATTTACCTTTCTAGTGCTGATTTTAGCAGGGTATTCGCTATCATGCCT[A/G]
GAAATTCACAAACCAGAATTTCTAAGCTGAATGTGCATTAAACCCCTGTCCAGGACCAGCCAGGGTACACAAATGACAATTGTTGTCATACAGACCCACG

Reverse complement sequence

CGTGGGTCTGTATGACAACAATTGTCATTTGTGTACCCTGGCTGGTCCTGGACAGGGGTTTAATGCACATTCAGCTTAGAAATTCTGGTTTGTGAATTTC[T/C]
AGGCATGATAGCGAATACCCTGCTAAAATCAGCACTAGAAAGGTAAATGGAAAAGCGCAAGGTTAAGACACGAACAAATGGGCGAAAAGAGTAGACTCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 35.20% 0.04% 0.08% NA
All Indica  2759 95.60% 4.20% 0.07% 0.14% NA
All Japonica  1512 5.40% 94.60% 0.00% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 98.00% 1.80% 0.00% 0.17% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 92.80% 7.00% 0.11% 0.11% NA
Indica Intermediate  786 95.30% 4.30% 0.13% 0.25% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 12.50% 87.50% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 41.70% 58.30% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203260505 A -> DEL N N silent_mutation Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg1203260505 A -> G LOC_Os12g06680.1 upstream_gene_variant ; 4435.0bp to feature; MODIFIER silent_mutation Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg1203260505 A -> G LOC_Os12g06700.1 upstream_gene_variant ; 1592.0bp to feature; MODIFIER silent_mutation Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg1203260505 A -> G LOC_Os12g06710.1 downstream_gene_variant ; 4336.0bp to feature; MODIFIER silent_mutation Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg1203260505 A -> G LOC_Os12g06690.1 intron_variant ; MODIFIER silent_mutation Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203260505 NA 1.85E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505 4.21E-06 NA mr1011 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505 NA 7.89E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505 NA 7.02E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505 NA 7.02E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505 NA 9.45E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251