\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203245777:

Variant ID: vg1203245777 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 3245777
Reference Allele: TAAlternative Allele: AA,TAA,T
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTCCCCATGTAAGCATGTCACATCCTAATCCCCTTCCTAGCATTGACATCCCAAATGAGTGCACATACTCACTCCATTCTTAAATATTCATTTTTTT[TA/AA,TAA,T]
AAAAAAATGTGCGTAGGAAAACCTAGAAATCTTATCGTTAATATATAAAAAGTATTCAGATTTCATATATGAAAATTATATCAATAGATTTTAAATACTT

Reverse complement sequence

AAGTATTTAAAATCTATTGATATAATTTTCATATATGAAATCTGAATACTTTTTATATATTAACGATAAGATTTCTAGGTTTTCCTACGCACATTTTTTT[TA/TT,TTA,A]
AAAAAAATGAATATTTAAGAATGGAGTGAGTATGTGCACTCATTTGGGATGTCAATGCTAGGAAGGGGATTAGGATGTGACATGCTTACATGGGGAATAA

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 10.00% 3.11% 0.00% T: 0.36%; TAA: 0.11%
All Indica  2759 96.90% 2.20% 0.69% 0.00% T: 0.22%
All Japonica  1512 67.30% 24.50% 8.07% 0.00% TAA: 0.13%; T: 0.07%
Aus  269 96.30% 1.10% 0.00% 0.00% T: 1.49%; TAA: 1.12%
Indica I  595 97.60% 0.70% 1.68% 0.00% NA
Indica II  465 98.90% 0.00% 0.86% 0.00% T: 0.22%
Indica III  913 94.00% 5.40% 0.22% 0.00% T: 0.44%
Indica Intermediate  786 98.50% 1.00% 0.38% 0.00% T: 0.13%
Temperate Japonica  767 65.10% 22.70% 11.99% 0.00% TAA: 0.26%
Tropical Japonica  504 84.50% 12.70% 2.78% 0.00% NA
Japonica Intermediate  241 38.20% 54.80% 6.64% 0.00% T: 0.41%
VI/Aromatic  96 62.50% 33.30% 0.00% 0.00% T: 4.17%
Intermediate  90 82.20% 8.90% 6.67% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203245777 TA -> AA LOC_Os12g06670.1 upstream_gene_variant ; 2071.0bp to feature; MODIFIER silent_mutation Average:89.152; most accessible tissue: Callus, score: 99.122 N N N N
vg1203245777 TA -> AA LOC_Os12g06680.1 downstream_gene_variant ; 4080.0bp to feature; MODIFIER silent_mutation Average:89.152; most accessible tissue: Callus, score: 99.122 N N N N
vg1203245777 TA -> AA LOC_Os12g06670-LOC_Os12g06680 intergenic_region ; MODIFIER silent_mutation Average:89.152; most accessible tissue: Callus, score: 99.122 N N N N
vg1203245777 TA -> TAA LOC_Os12g06670.1 upstream_gene_variant ; 2073.0bp to feature; MODIFIER silent_mutation Average:89.152; most accessible tissue: Callus, score: 99.122 N N N N
vg1203245777 TA -> TAA LOC_Os12g06680.1 downstream_gene_variant ; 4078.0bp to feature; MODIFIER silent_mutation Average:89.152; most accessible tissue: Callus, score: 99.122 N N N N
vg1203245777 TA -> TAA LOC_Os12g06670-LOC_Os12g06680 intergenic_region ; MODIFIER silent_mutation Average:89.152; most accessible tissue: Callus, score: 99.122 N N N N
vg1203245777 TA -> T LOC_Os12g06670.1 upstream_gene_variant ; 2072.0bp to feature; MODIFIER silent_mutation Average:89.152; most accessible tissue: Callus, score: 99.122 N N N N
vg1203245777 TA -> T LOC_Os12g06680.1 downstream_gene_variant ; 4079.0bp to feature; MODIFIER silent_mutation Average:89.152; most accessible tissue: Callus, score: 99.122 N N N N
vg1203245777 TA -> T LOC_Os12g06670-LOC_Os12g06680 intergenic_region ; MODIFIER silent_mutation Average:89.152; most accessible tissue: Callus, score: 99.122 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1203245777 TA AA -0.01 -0.02 -0.01 0.0 -0.02 -0.01
vg1203245777 TA T -0.02 -0.04 -0.02 -0.01 -0.01 0.02
vg1203245777 TA TAA -0.03 -0.08 -0.05 -0.02 -0.03 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203245777 NA 3.76E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203245777 6.81E-06 6.81E-06 mr1293_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203245777 NA 1.20E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203245777 4.61E-06 4.61E-06 mr1648_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203245777 6.26E-06 6.26E-06 mr1655_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203245777 4.54E-06 4.54E-06 mr1669_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203245777 6.09E-06 6.09E-06 mr1756_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203245777 NA 4.53E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251