\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203225321:

Variant ID: vg1203225321 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3225321
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATTAGGGAAGCGAGTGGTTTTTACTCACAAAGTAATCCAACAATTATCAACAATTGTGTTATTGAATTTGTGGCTGCGCCTTTGTAGTATTATGGCTT[A/C]
CATCGTGAGAAATTGAAAAAAAATTGATAGGATATATTAATATGAAATATAACACTCTACAAACATGCAAGTTAAAATTCAACTTTTAAAAATTGTAAAA

Reverse complement sequence

TTTTACAATTTTTAAAAGTTGAATTTTAACTTGCATGTTTGTAGAGTGTTATATTTCATATTAATATATCCTATCAATTTTTTTTCAATTTCTCACGATG[T/G]
AAGCCATAATACTACAAAGGCGCAGCCACAAATTCAATAACACAATTGTTGATAATTGTTGGATTACTTTGTGAGTAAAAACCACTCGCTTCCCTAATCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.80% 0.00% 0.00% NA
All Indica  2759 93.60% 6.40% 0.00% 0.00% NA
All Japonica  1512 3.30% 96.70% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 94.60% 5.40% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 91.20% 8.80% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203225321 A -> C LOC_Os12g06640.1 upstream_gene_variant ; 2414.0bp to feature; MODIFIER silent_mutation Average:70.939; most accessible tissue: Minghui63 flag leaf, score: 89.812 N N N N
vg1203225321 A -> C LOC_Os12g06640.2 upstream_gene_variant ; 2414.0bp to feature; MODIFIER silent_mutation Average:70.939; most accessible tissue: Minghui63 flag leaf, score: 89.812 N N N N
vg1203225321 A -> C LOC_Os12g06650.1 downstream_gene_variant ; 1198.0bp to feature; MODIFIER silent_mutation Average:70.939; most accessible tissue: Minghui63 flag leaf, score: 89.812 N N N N
vg1203225321 A -> C LOC_Os12g06640-LOC_Os12g06650 intergenic_region ; MODIFIER silent_mutation Average:70.939; most accessible tissue: Minghui63 flag leaf, score: 89.812 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1203225321 A C -0.01 0.0 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203225321 NA 1.08E-102 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 7.73E-101 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 8.65E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 6.35E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.93E-74 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 2.79E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.24E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.25E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.08E-56 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.49E-25 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.52E-40 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.92E-32 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.37E-83 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.62E-37 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 9.79E-38 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.15E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.19E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 3.98E-76 mr1865 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 5.43E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.41E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.40E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 3.60E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 1.29E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 4.08E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203225321 NA 7.54E-66 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251