\
| Variant ID: vg1203199364 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 3199364 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 300. )
AAACTATTGTGTGGCTGAGAGAAGAGACCATTGAAAAGAGCTCATTTTCATGATGTACTTCTCTTCTATTCTGCATGGTGGGATGGCTTATGCCTTAATG[C/T]
GATTCAAGTGGCTTTTCTAAGCAGAGATGTTGACCTGCAGAACATCTCAGAAGGAACACACCTATATGAGTTCGACTGCTAGTCACAGTATATGAGATTT
AAATCTCATATACTGTGACTAGCAGTCGAACTCATATAGGTGTGTTCCTTCTGAGATGTTCTGCAGGTCAACATCTCTGCTTAGAAAAGCCACTTGAATC[G/A]
CATTAAGGCATAAGCCATCCCACCATGCAGAATAGAAGAGAAGTACATCATGAAAATGAGCTCTTTTCAATGGTCTCTTCTCTCAGCCACACAATAGTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.20% | 34.70% | 0.91% | 2.20% | NA |
| All Indica | 2759 | 93.60% | 6.30% | 0.07% | 0.07% | NA |
| All Japonica | 1512 | 3.50% | 87.30% | 2.51% | 6.68% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.30% | 8.30% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 97.90% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 7.10% | 70.00% | 5.95% | 16.87% | NA |
| Japonica Intermediate | 241 | 2.50% | 89.60% | 2.90% | 4.98% | NA |
| VI/Aromatic | 96 | 8.30% | 90.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 63.30% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1203199364 | C -> DEL | N | N | silent_mutation | Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1203199364 | C -> T | LOC_Os12g06610.1 | upstream_gene_variant ; 2251.0bp to feature; MODIFIER | silent_mutation | Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1203199364 | C -> T | LOC_Os12g06590.1 | downstream_gene_variant ; 2462.0bp to feature; MODIFIER | silent_mutation | Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg1203199364 | C -> T | LOC_Os12g06600.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1203199364 | NA | 1.39E-26 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | NA | 7.67E-30 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | NA | 8.50E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | NA | 1.55E-30 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | NA | 6.23E-44 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | NA | 9.77E-39 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | NA | 2.77E-37 | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | NA | 1.29E-30 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | 4.62E-06 | NA | mr1794 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | NA | 6.17E-70 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1203199364 | NA | 1.34E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |