Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203199364:

Variant ID: vg1203199364 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3199364
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

AAACTATTGTGTGGCTGAGAGAAGAGACCATTGAAAAGAGCTCATTTTCATGATGTACTTCTCTTCTATTCTGCATGGTGGGATGGCTTATGCCTTAATG[C/T]
GATTCAAGTGGCTTTTCTAAGCAGAGATGTTGACCTGCAGAACATCTCAGAAGGAACACACCTATATGAGTTCGACTGCTAGTCACAGTATATGAGATTT

Reverse complement sequence

AAATCTCATATACTGTGACTAGCAGTCGAACTCATATAGGTGTGTTCCTTCTGAGATGTTCTGCAGGTCAACATCTCTGCTTAGAAAAGCCACTTGAATC[G/A]
CATTAAGGCATAAGCCATCCCACCATGCAGAATAGAAGAGAAGTACATCATGAAAATGAGCTCTTTTCAATGGTCTCTTCTCTCAGCCACACAATAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.20%	34.70%	0.91%	2.20%	NA
All Indica	2759	93.60%	6.30%	0.07%	0.07%	NA
All Japonica	1512	3.50%	87.30%	2.51%	6.68%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.30%	5.50%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	91.30%	8.30%	0.11%	0.22%	NA
Indica Intermediate	786	92.90%	7.10%	0.00%	0.00%	NA
Temperate Japonica	767	1.40%	97.90%	0.13%	0.52%	NA
Tropical Japonica	504	7.10%	70.00%	5.95%	16.87%	NA
Japonica Intermediate	241	2.50%	89.60%	2.90%	4.98%	NA
VI/Aromatic	96	8.30%	90.60%	1.04%	0.00%	NA
Intermediate	90	33.30%	63.30%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203199364	C -> DEL	N	N	silent_mutation	Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg1203199364	C -> T	LOC_Os12g06610.1	upstream_gene_variant ; 2251.0bp to feature; MODIFIER	silent_mutation	Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg1203199364	C -> T	LOC_Os12g06590.1	downstream_gene_variant ; 2462.0bp to feature; MODIFIER	silent_mutation	Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg1203199364	C -> T	LOC_Os12g06600.1	intron_variant ; MODIFIER	silent_mutation	Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203199364	NA	1.39E-26	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	NA	7.67E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	NA	8.50E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	NA	1.55E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	NA	6.23E-44	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	NA	9.77E-39	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	NA	2.77E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	NA	1.29E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	4.62E-06	NA	mr1794	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	NA	6.17E-70	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364	NA	1.34E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251