\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203199364:

Variant ID: vg1203199364 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3199364
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTATTGTGTGGCTGAGAGAAGAGACCATTGAAAAGAGCTCATTTTCATGATGTACTTCTCTTCTATTCTGCATGGTGGGATGGCTTATGCCTTAATG[C/T]
GATTCAAGTGGCTTTTCTAAGCAGAGATGTTGACCTGCAGAACATCTCAGAAGGAACACACCTATATGAGTTCGACTGCTAGTCACAGTATATGAGATTT

Reverse complement sequence

AAATCTCATATACTGTGACTAGCAGTCGAACTCATATAGGTGTGTTCCTTCTGAGATGTTCTGCAGGTCAACATCTCTGCTTAGAAAAGCCACTTGAATC[G/A]
CATTAAGGCATAAGCCATCCCACCATGCAGAATAGAAGAGAAGTACATCATGAAAATGAGCTCTTTTCAATGGTCTCTTCTCTCAGCCACACAATAGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 34.70% 0.91% 2.20% NA
All Indica  2759 93.60% 6.30% 0.07% 0.07% NA
All Japonica  1512 3.50% 87.30% 2.51% 6.68% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.30% 5.50% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 91.30% 8.30% 0.11% 0.22% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 1.40% 97.90% 0.13% 0.52% NA
Tropical Japonica  504 7.10% 70.00% 5.95% 16.87% NA
Japonica Intermediate  241 2.50% 89.60% 2.90% 4.98% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 33.30% 63.30% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203199364 C -> DEL N N silent_mutation Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1203199364 C -> T LOC_Os12g06610.1 upstream_gene_variant ; 2251.0bp to feature; MODIFIER silent_mutation Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1203199364 C -> T LOC_Os12g06590.1 downstream_gene_variant ; 2462.0bp to feature; MODIFIER silent_mutation Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg1203199364 C -> T LOC_Os12g06600.1 intron_variant ; MODIFIER silent_mutation Average:41.542; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203199364 NA 1.39E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 NA 7.67E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 NA 8.50E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 NA 1.55E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 NA 6.23E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 NA 9.77E-39 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 NA 2.77E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 NA 1.29E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 4.62E-06 NA mr1794 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 NA 6.17E-70 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203199364 NA 1.34E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251