\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203150141:

Variant ID: vg1203150141 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3150141
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAAGACGTGCTCCCTCCGTCTTAAAAAAATCTAACCTAGGAGGGGATTTGATCCCTTCTAGTACAACGAATCTAGATAGAAGTTTGTCCAGATTCATT[G/A]
TACTATGGGGGGTCACATCCCCTCGTAGGTTGGGTTTTTTTGGGAGCAGTATAGCTAGCGACTCTATGATAAGCACTAGAAAACTGTAAAATGAACTTGC

Reverse complement sequence

GCAAGTTCATTTTACAGTTTTCTAGTGCTTATCATAGAGTCGCTAGCTATACTGCTCCCAAAAAAACCCAACCTACGAGGGGATGTGACCCCCCATAGTA[C/T]
AATGAATCTGGACAAACTTCTATCTAGATTCGTTGTACTAGAAGGGATCAAATCCCCTCCTAGGTTAGATTTTTTTAAGACGGAGGGAGCACGTCTTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 3.60% 1.95% 0.00% NA
All Indica  2759 99.90% 0.00% 0.04% 0.00% NA
All Japonica  1512 83.20% 10.90% 5.89% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 88.00% 3.50% 8.47% 0.00% NA
Tropical Japonica  504 91.30% 7.10% 1.59% 0.00% NA
Japonica Intermediate  241 51.00% 42.30% 6.64% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203150141 G -> A LOC_Os12g06510.1 upstream_gene_variant ; 622.0bp to feature; MODIFIER silent_mutation Average:68.977; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1203150141 G -> A LOC_Os12g06520.1 upstream_gene_variant ; 2874.0bp to feature; MODIFIER silent_mutation Average:68.977; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1203150141 G -> A LOC_Os12g06510.3 upstream_gene_variant ; 574.0bp to feature; MODIFIER silent_mutation Average:68.977; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1203150141 G -> A LOC_Os12g06510.2 upstream_gene_variant ; 574.0bp to feature; MODIFIER silent_mutation Average:68.977; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1203150141 G -> A LOC_Os12g06510-LOC_Os12g06520 intergenic_region ; MODIFIER silent_mutation Average:68.977; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203150141 NA 1.74E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 3.58E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 2.72E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 5.05E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 2.85E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 9.25E-07 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 4.07E-09 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 1.34E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 3.58E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 7.72E-09 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 4.36E-09 4.36E-09 mr1881 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 8.55E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 7.38E-06 3.68E-09 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 1.30E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 5.79E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 2.49E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 2.04E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 1.50E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 2.43E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 3.54E-08 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 4.63E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 8.43E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 1.06E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 5.20E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 6.29E-06 8.82E-07 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 1.41E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203150141 NA 2.69E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251