\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203128564:

Variant ID: vg1203128564 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 3128564
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAAAAAAATTTATATAAGACGAACAATCAAAGTTGGACACGGAAACCCAGAGTTTGTCTTTTTTTTGGGACGGAGGGATTATCTCGTTTTCCACTTTC[G/A]
ACTTCTAATCATGTATCCTCAATTCAGGGAAGGAGAATGTGCAATAAATAAAACCGGCAGCATAAAGCCGATGGAAACAAATGCAAAGTGCACAGCCAAT

Reverse complement sequence

ATTGGCTGTGCACTTTGCATTTGTTTCCATCGGCTTTATGCTGCCGGTTTTATTTATTGCACATTCTCCTTCCCTGAATTGAGGATACATGATTAGAAGT[C/T]
GAAAGTGGAAAACGAGATAATCCCTCCGTCCCAAAAAAAAGACAAACTCTGGGTTTCCGTGTCCAACTTTGATTGTTCGTCTTATATAAATTTTTTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 3.40% 0.74% 0.00% NA
All Indica  2759 99.90% 0.00% 0.04% 0.00% NA
All Japonica  1512 87.40% 10.40% 2.18% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 94.90% 2.90% 2.22% 0.00% NA
Tropical Japonica  504 92.50% 6.90% 0.60% 0.00% NA
Japonica Intermediate  241 53.10% 41.50% 5.39% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203128564 G -> A LOC_Os12g06490.1 3_prime_UTR_variant ; 433.0bp to feature; MODIFIER silent_mutation Average:63.154; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1203128564 G -> A LOC_Os12g06490.2 3_prime_UTR_variant ; 433.0bp to feature; MODIFIER silent_mutation Average:63.154; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1203128564 G -> A LOC_Os12g06480.2 upstream_gene_variant ; 3785.0bp to feature; MODIFIER silent_mutation Average:63.154; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1203128564 G -> A LOC_Os12g06480.1 upstream_gene_variant ; 3785.0bp to feature; MODIFIER silent_mutation Average:63.154; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203128564 NA 5.45E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 4.01E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 2.64E-08 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 2.90E-09 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 9.85E-09 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 5.61E-09 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 3.38E-07 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 2.05E-09 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 2.64E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 6.89E-10 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 2.20E-06 1.27E-10 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 1.49E-09 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 8.59E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 9.47E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 2.34E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 1.16E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 4.91E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 3.27E-10 1.50E-14 mr1113_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 5.35E-10 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 4.38E-06 2.56E-11 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 5.29E-06 8.00E-12 mr1118_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 5.32E-06 1.75E-11 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 4.97E-09 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 4.17E-09 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 5.65E-07 6.67E-14 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 4.52E-10 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 3.67E-09 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 6.68E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 2.27E-06 3.61E-12 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 3.22E-07 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 9.46E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203128564 NA 7.88E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251