\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203113723:

Variant ID: vg1203113723 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 3113723
Reference Allele: TAlternative Allele: C,TAAC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCCAAATTTCTTCTCAATTTCAGGGTGTGTTAGTTTCAAAATTTTTATTTTTCTAAATTTTTAACTTTTCATCACATCAAATCTTTCATACACACGTAA[T/C,TAAC]
TTTTCAGTCACATTGCAAAGCCTTCGTTTCACGTCGTGTTGTTGCTGCTCCACACACCTAGTATACTCTTACTCCTACTACCGGTAGTAGAGTAGTGCTA

Reverse complement sequence

TAGCACTACTCTACTACCGGTAGTAGGAGTAAGAGTATACTAGGTGTGTGGAGCAGCAACAACACGACGTGAAACGAAGGCTTTGCAATGTGACTGAAAA[A/G,GTTA]
TTACGTGTGTATGAAAGATTTGATGTGATGAAAAGTTAAAAATTTAGAAAAATAAAAATTTTGAAACTAACACACCCTGAAATTGAGAAGAAATTTGGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 11.40% 1.08% 0.00% TAAC: 0.04%
All Indica  2759 97.00% 2.60% 0.33% 0.00% NA
All Japonica  1512 67.70% 29.60% 2.65% 0.00% TAAC: 0.13%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 1.30% 0.84% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 96.40% 3.60% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 2.90% 0.51% 0.00% NA
Temperate Japonica  767 42.40% 53.60% 3.78% 0.00% TAAC: 0.26%
Tropical Japonica  504 97.60% 1.40% 0.99% 0.00% NA
Japonica Intermediate  241 85.50% 12.00% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 18.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1203113723 T -> C LOC_Os12g06464.1 upstream_gene_variant ; 3307.0bp to feature; MODIFIER silent_mutation Average:70.896; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg1203113723 T -> C LOC_Os12g06480.2 downstream_gene_variant ; 4304.0bp to feature; MODIFIER silent_mutation Average:70.896; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg1203113723 T -> C LOC_Os12g06480.1 downstream_gene_variant ; 4317.0bp to feature; MODIFIER silent_mutation Average:70.896; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg1203113723 T -> C LOC_Os12g06464-LOC_Os12g06480 intergenic_region ; MODIFIER silent_mutation Average:70.896; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg1203113723 T -> TAAC LOC_Os12g06464.1 upstream_gene_variant ; 3308.0bp to feature; MODIFIER silent_mutation Average:70.896; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg1203113723 T -> TAAC LOC_Os12g06480.2 downstream_gene_variant ; 4303.0bp to feature; MODIFIER silent_mutation Average:70.896; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg1203113723 T -> TAAC LOC_Os12g06480.1 downstream_gene_variant ; 4316.0bp to feature; MODIFIER silent_mutation Average:70.896; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N
vg1203113723 T -> TAAC LOC_Os12g06464-LOC_Os12g06480 intergenic_region ; MODIFIER silent_mutation Average:70.896; most accessible tissue: Zhenshan97 panicle, score: 97.598 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1203113723 T C 0.03 0.01 0.03 0.09 0.05 0.02
vg1203113723 T TAAC 0.03 -0.06 0.0 -0.13 -0.09 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1203113723 NA 1.46E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1203113723 NA 2.38E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1203113723 NA 2.58E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1203113723 NA 8.94E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 8.30E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 2.11E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 3.30E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 5.71E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 5.38E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 6.98E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 2.97E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 1.43E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 3.05E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 6.04E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 1.11E-10 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 7.74E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 9.69E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 1.24E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 1.69E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 4.48E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 2.25E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 7.22E-07 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 1.49E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 2.98E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 2.45E-10 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 2.30E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 6.51E-10 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 2.98E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 3.88E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 6.99E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 1.44E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 6.09E-06 5.55E-09 mr1596_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 3.60E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 2.93E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 1.11E-09 mr1763_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 4.57E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 4.52E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 4.64E-11 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 7.73E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203113723 NA 3.67E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251