Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203005112:

Variant ID: vg1203005112 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3005112
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTTTGGTTAAAATTGGAACGATGTGATGGAAACGTTGAAAGTTTATGTGTGTAGGAAAGTTTTGATGTGATGAAAAAGTTGAAAGTTTGAAAAAAAAA[T/A]
TTAGAACTAAACAAGGCCTCTATCCGTTCTAACATATAACGGATCCTAAATGAATAGAATATTTTATAGGGTTTGTTGGAACTATGCCACCCTAATTTTA

Reverse complement sequence

TAAAATTAGGGTGGCATAGTTCCAACAAACCCTATAAAATATTCTATTCATTTAGGATCCGTTATATGTTAGAACGGATAGAGGCCTTGTTTAGTTCTAA[A/T]
TTTTTTTTTCAAACTTTCAACTTTTTCATCACATCAAAACTTTCCTACACACATAAACTTTCAACGTTTCCATCACATCGTTCCAATTTTAACCAAACTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	12.90%	0.25%	0.00%	NA
All Indica	2759	83.40%	16.20%	0.40%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	45.70%	53.90%	0.37%	0.00%	NA
Indica I	595	90.60%	9.10%	0.34%	0.00%	NA
Indica II	465	84.30%	15.50%	0.22%	0.00%	NA
Indica III	913	80.00%	19.70%	0.33%	0.00%	NA
Indica Intermediate	786	81.40%	17.90%	0.64%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203005112	T -> A	LOC_Os12g06290.1	downstream_gene_variant ; 2458.0bp to feature; MODIFIER	silent_mutation	Average:47.224; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg1203005112	T -> A	LOC_Os12g06280-LOC_Os12g06290	intergenic_region ; MODIFIER	silent_mutation	Average:47.224; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203005112	NA	4.59E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	1.74E-06	mr1196	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	2.06E-07	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	3.67E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	8.58E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	2.14E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	7.74E-06	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	5.00E-06	mr1472	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	1.44E-06	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	5.80E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	8.65E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	1.70E-06	1.70E-06	mr1569	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	5.21E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	4.93E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	2.14E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	3.66E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	4.03E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	8.04E-06	mr1948	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	8.30E-06	mr1972	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203005112	NA	5.51E-06	mr1988	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251