\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202865165:

Variant ID: vg1202865165 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2865165
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, A: 0.11, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TCATAAAGGGCATTCAAGATGTTAACACTGTCATACAGCTATTGCCAACTGCTGCATGGTGTAAACATACTCACAGGTATTGGCAATAGCATGGTGGATA[A/C]
GCAGAGGGGGCAATCACCAGCAGGACAAGTTGATTTGGGGCTCACCAATATGACAGGAAAGTGTCTTAAGTTCGTATCACAGGATTCATGTTTTACATTT

Reverse complement sequence

AAATGTAAAACATGAATCCTGTGATACGAACTTAAGACACTTTCCTGTCATATTGGTGAGCCCCAAATCAACTTGTCCTGCTGGTGATTGCCCCCTCTGC[T/G]
TATCCACCATGCTATTGCCAATACCTGTGAGTATGTTTACACCATGCAGCAGTTGGCAATAGCTGTATGACAGTGTTAACATCTTGAATGCCCTTTATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 14.50% 0.04% 0.25% NA
All Indica  2759 82.50% 17.00% 0.07% 0.43% NA
All Japonica  1512 97.20% 2.80% 0.00% 0.00% NA
Aus  269 38.70% 61.30% 0.00% 0.00% NA
Indica I  595 91.60% 8.20% 0.00% 0.17% NA
Indica II  465 84.10% 15.50% 0.00% 0.43% NA
Indica III  913 74.80% 24.50% 0.11% 0.55% NA
Indica Intermediate  786 83.60% 15.80% 0.13% 0.51% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202865165 A -> C LOC_Os12g06130.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:56.178; most accessible tissue: Callus, score: 84.768 N N N N
vg1202865165 A -> C LOC_Os12g06120.1 downstream_gene_variant ; 4382.0bp to feature; MODIFIER silent_mutation Average:56.178; most accessible tissue: Callus, score: 84.768 N N N N
vg1202865165 A -> C LOC_Os12g06120-LOC_Os12g06130 intergenic_region ; MODIFIER silent_mutation Average:56.178; most accessible tissue: Callus, score: 84.768 N N N N
vg1202865165 A -> DEL N N silent_mutation Average:56.178; most accessible tissue: Callus, score: 84.768 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202865165 NA 7.36E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 1.25E-06 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 8.42E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 5.90E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 5.07E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 7.40E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 3.63E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 7.91E-06 7.91E-06 mr1569 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 7.19E-06 mr1611 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 9.96E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 3.20E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 2.59E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 2.93E-06 2.93E-06 mr1953 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202865165 NA 5.78E-06 mr1963 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251