\
| Variant ID: vg1202805818 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2805818 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )
CAGAGAATATGTTCAGGTATTAATTAATTACCTGCAATGTTATATGGACATATGTATGTGTTTTTTCACTTTATATTTTACTGAGCTACTCCCTCCGTTT[C/T]
ATAATATTGTTTAAATTCATTAGTATTTATATGAATATTGACAATAATAGGAAGTCTTATATTAAAAAATAGAAGAAATAATTAAGGTTCACGGATTTAT
ATAAATCCGTGAACCTTAATTATTTCTTCTATTTTTTAATATAAGACTTCCTATTATTGTCAATATTCATATAAATACTAATGAATTTAAACAATATTAT[G/A]
AAACGGAGGGAGTAGCTCAGTAAAATATAAAGTGAAAAAACACATACATATGTCCATATAACATTGCAGGTAATTAATTAATACCTGAACATATTCTCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 2.00% | 0.91% | 0.00% | NA |
| All Indica | 2759 | 95.30% | 3.40% | 1.34% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.40% | 1.12% | 0.00% | NA |
| Indica I | 595 | 86.70% | 8.60% | 4.71% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 3.40% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202805818 | C -> T | LOC_Os12g06040.1 | upstream_gene_variant ; 4043.0bp to feature; MODIFIER | silent_mutation | Average:51.077; most accessible tissue: Callus, score: 85.986 | N | N | N | N |
| vg1202805818 | C -> T | LOC_Os12g06050.1 | downstream_gene_variant ; 3734.0bp to feature; MODIFIER | silent_mutation | Average:51.077; most accessible tissue: Callus, score: 85.986 | N | N | N | N |
| vg1202805818 | C -> T | LOC_Os12g06040-LOC_Os12g06050 | intergenic_region ; MODIFIER | silent_mutation | Average:51.077; most accessible tissue: Callus, score: 85.986 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202805818 | NA | 4.65E-08 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202805818 | 7.44E-06 | 3.58E-09 | mr1128 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202805818 | NA | 7.01E-08 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202805818 | NA | 2.84E-08 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202805818 | NA | 9.68E-07 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202805818 | NA | 1.58E-09 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202805818 | NA | 3.18E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202805818 | NA | 4.47E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202805818 | NA | 3.77E-06 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202805818 | NA | 8.01E-07 | mr1579_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |