\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202805818:

Variant ID: vg1202805818 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2805818
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CAGAGAATATGTTCAGGTATTAATTAATTACCTGCAATGTTATATGGACATATGTATGTGTTTTTTCACTTTATATTTTACTGAGCTACTCCCTCCGTTT[C/T]
ATAATATTGTTTAAATTCATTAGTATTTATATGAATATTGACAATAATAGGAAGTCTTATATTAAAAAATAGAAGAAATAATTAAGGTTCACGGATTTAT

Reverse complement sequence

ATAAATCCGTGAACCTTAATTATTTCTTCTATTTTTTAATATAAGACTTCCTATTATTGTCAATATTCATATAAATACTAATGAATTTAAACAATATTAT[G/A]
AAACGGAGGGAGTAGCTCAGTAAAATATAAAGTGAAAAAACACATACATATGTCCATATAACATTGCAGGTAATTAATTAATACCTGAACATATTCTCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.00% 0.91% 0.00% NA
All Indica  2759 95.30% 3.40% 1.34% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 98.50% 0.40% 1.12% 0.00% NA
Indica I  595 86.70% 8.60% 4.71% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 3.40% 1.15% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202805818 C -> T LOC_Os12g06040.1 upstream_gene_variant ; 4043.0bp to feature; MODIFIER silent_mutation Average:51.077; most accessible tissue: Callus, score: 85.986 N N N N
vg1202805818 C -> T LOC_Os12g06050.1 downstream_gene_variant ; 3734.0bp to feature; MODIFIER silent_mutation Average:51.077; most accessible tissue: Callus, score: 85.986 N N N N
vg1202805818 C -> T LOC_Os12g06040-LOC_Os12g06050 intergenic_region ; MODIFIER silent_mutation Average:51.077; most accessible tissue: Callus, score: 85.986 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202805818 NA 4.65E-08 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202805818 7.44E-06 3.58E-09 mr1128 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202805818 NA 7.01E-08 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202805818 NA 2.84E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202805818 NA 9.68E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202805818 NA 1.58E-09 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202805818 NA 3.18E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202805818 NA 4.47E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202805818 NA 3.77E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202805818 NA 8.01E-07 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251