\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202777536:

Variant ID: vg1202777536 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 2777536
Reference Allele: TGAATATACGAGTTGGGATTGAAGTTGAlternative Allele: GGAATATACGAGTTGGGATTGAAGTTG,T
Primary Allele: TGAATATACGAGTTGGGATT GAAGTTGSecondary Allele: GGAATATACGAGTTGGGATT GAAGTTG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTCTATGTGTGCTGGGTAATGAAGCATGTATGTGGCAAGCAGCAATAGAATACATACCTACTCTACTCTTATGTGATGTTTGTGTTAGAATAGGGGT[TGAATATACGAGTTGGGATTGAAGTTG/GGAATATACGAGTTGGGATTGAAGTTG,T]
GAATAGGTATAATATCCCTCTAAAATAGAGACGGGGCACCACAATCACGGCGACTACAATGAGTGTTGGAATAGGTATAATATATAGTTAGAGAGTTGAA

Reverse complement sequence

TTCAACTCTCTAACTATATATTATACCTATTCCAACACTCATTGTAGTCGCCGTGATTGTGGTGCCCCGTCTCTATTTTAGAGGGATATTATACCTATTC[CAACTTCAATCCCAACTCGTATATTCA/CAACTTCAATCCCAACTCGTATATTCC,A]
ACCCCTATTCTAACACAAACATCACATAAGAGTAGAGTAGGTATGTATTCTATTGCTGCTTGCCACATACATGCTTCATTACCCAGCACACATAGAATTT

Allele Frequencies:

Populations Population SizeFrequency of TGAATATACGAGTTGGGATT GAAGTTG(primary allele) Frequency of GGAATATACGAGTTGGGATT GAAGTTG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 8.20% 3.36% 2.01% T: 2.33%
All Indica  2759 93.40% 0.40% 1.81% 1.01% T: 3.37%
All Japonica  1512 73.10% 24.20% 2.58% 0.07% NA
Aus  269 44.20% 0.00% 24.91% 24.54% T: 6.32%
Indica I  595 93.40% 0.00% 1.01% 0.00% T: 5.55%
Indica II  465 98.30% 0.40% 0.43% 0.43% T: 0.43%
Indica III  913 91.70% 0.10% 2.52% 0.99% T: 4.71%
Indica Intermediate  786 92.60% 0.90% 2.42% 2.16% T: 1.91%
Temperate Japonica  767 96.60% 2.70% 0.65% 0.00% NA
Tropical Japonica  504 33.70% 60.30% 5.75% 0.20% NA
Japonica Intermediate  241 80.90% 17.00% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202777536 TGAATATACGAGTTGGGATTGAAGTTG -> DEL N N silent_mutation Average:82.489; most accessible tissue: Zhenshan97 root, score: 97.67 N N N N
vg1202777536 TGAATATACGAGTTGGGATTGAAGTTG -> GGAATATACGAGTTGGGATTGAAGTTG LOC_Os12g06020.1 upstream_gene_variant ; 3014.0bp to feature; MODIFIER silent_mutation Average:82.489; most accessible tissue: Zhenshan97 root, score: 97.67 N N N N
vg1202777536 TGAATATACGAGTTGGGATTGAAGTTG -> GGAATATACGAGTTGGGATTGAAGTTG LOC_Os12g06010.1 downstream_gene_variant ; 520.0bp to feature; MODIFIER silent_mutation Average:82.489; most accessible tissue: Zhenshan97 root, score: 97.67 N N N N
vg1202777536 TGAATATACGAGTTGGGATTGAAGTTG -> GGAATATACGAGTTGGGATTGAAGTTG LOC_Os12g06010-LOC_Os12g06020 intergenic_region ; MODIFIER silent_mutation Average:82.489; most accessible tissue: Zhenshan97 root, score: 97.67 N N N N
vg1202777536 TGAATATACGAGTTGGGATTGAAGTTG -> T LOC_Os12g06020.1 upstream_gene_variant ; 3013.0bp to feature; MODIFIER silent_mutation Average:82.489; most accessible tissue: Zhenshan97 root, score: 97.67 N N N N
vg1202777536 TGAATATACGAGTTGGGATTGAAGTTG -> T LOC_Os12g06010.1 downstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:82.489; most accessible tissue: Zhenshan97 root, score: 97.67 N N N N
vg1202777536 TGAATATACGAGTTGGGATTGAAGTTG -> T LOC_Os12g06010-LOC_Os12g06020 intergenic_region ; MODIFIER silent_mutation Average:82.489; most accessible tissue: Zhenshan97 root, score: 97.67 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1202777536 TGAAT* GGAAT* 0.05 0.03 0.02 0.03 0.04 0.03
vg1202777536 TGAAT* T 0.01 0.08 0.11 -0.22 -0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202777536 NA 6.11E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 3.48E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 7.90E-07 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 4.35E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 2.86E-06 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 9.25E-11 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.20E-12 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 1.10E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.93E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 3.41E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 1.61E-22 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 9.99E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.36E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 4.73E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.10E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 1.95E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 6.85E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 9.75E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 3.72E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 5.15E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 3.95E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.92E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 9.27E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 1.66E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 4.91E-07 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 4.06E-12 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 4.26E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 6.57E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 9.50E-12 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 3.82E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 4.05E-07 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 7.08E-06 1.38E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 1.63E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 2.93E-06 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 6.94E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 4.08E-07 1.01E-25 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 7.22E-17 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 5.06E-10 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.63E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 9.06E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 1.08E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 2.06E-07 1.70E-14 mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.51E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 3.67E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 5.86E-16 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 4.27E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 2.46E-08 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 1.08E-06 1.46E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 1.95E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 7.20E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 1.45E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 1.06E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 7.75E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 1.03E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 1.07E-13 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.34E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 8.34E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 1.20E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.27E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 4.13E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.47E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 5.65E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 2.95E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 3.52E-11 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 9.28E-06 1.30E-13 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202777536 NA 6.58E-15 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251