\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202736323:

Variant ID: vg1202736323 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2736323
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGGCTTAGAAACAAAGAAATAAACCATGCGAGGTGCATTTGGGGTTGCTATTTGGCGCGCGCGCGCACGCGTTTTCGTTTTCTTTTGCCATCTTTTTC[G/A]
CGTTTTCTTTTTTTTTTCTGCCATCTTTTTTGTTTTTTCCTTTTTTTTTCACGTCCCCTCCCCTAGCATGTTTTACCTTTTTTTCGCTTTTTTTTTTCTG

Reverse complement sequence

CAGAAAAAAAAAAGCGAAAAAAAGGTAAAACATGCTAGGGGAGGGGACGTGAAAAAAAAAGGAAAAAACAAAAAAGATGGCAGAAAAAAAAAAGAAAACG[C/T]
GAAAAAGATGGCAAAAGAAAACGAAAACGCGTGCGCGCGCGCGCCAAATAGCAACCCCAAATGCACCTCGCATGGTTTATTTCTTTGTTTCTAAGCCTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 36.80% 5.59% 0.00% NA
All Indica  2759 80.90% 12.30% 6.81% 0.00% NA
All Japonica  1512 23.50% 72.20% 4.30% 0.00% NA
Aus  269 1.10% 97.80% 1.12% 0.00% NA
Indica I  595 64.70% 17.00% 18.32% 0.00% NA
Indica II  465 91.60% 4.10% 4.30% 0.00% NA
Indica III  913 88.90% 10.50% 0.55% 0.00% NA
Indica Intermediate  786 77.50% 15.60% 6.87% 0.00% NA
Temperate Japonica  767 5.50% 91.30% 3.26% 0.00% NA
Tropical Japonica  504 47.00% 47.60% 5.36% 0.00% NA
Japonica Intermediate  241 31.50% 63.10% 5.39% 0.00% NA
VI/Aromatic  96 86.50% 10.40% 3.12% 0.00% NA
Intermediate  90 55.60% 38.90% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202736323 G -> A LOC_Os12g05930.1 upstream_gene_variant ; 3156.0bp to feature; MODIFIER silent_mutation Average:60.374; most accessible tissue: Callus, score: 86.693 N N N N
vg1202736323 G -> A LOC_Os12g05940.1 upstream_gene_variant ; 1423.0bp to feature; MODIFIER silent_mutation Average:60.374; most accessible tissue: Callus, score: 86.693 N N N N
vg1202736323 G -> A LOC_Os12g05950.1 upstream_gene_variant ; 4681.0bp to feature; MODIFIER silent_mutation Average:60.374; most accessible tissue: Callus, score: 86.693 N N N N
vg1202736323 G -> A LOC_Os12g05930-LOC_Os12g05940 intergenic_region ; MODIFIER silent_mutation Average:60.374; most accessible tissue: Callus, score: 86.693 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202736323 NA 3.65E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 4.98E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 1.60E-12 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 2.32E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 2.39E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 7.90E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 1.27E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 4.24E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 1.55E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 5.52E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 1.97E-07 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 2.41E-06 NA mr1023_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 1.45E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 3.67E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 5.46E-26 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 7.30E-07 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 2.25E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 3.07E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 3.97E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 4.56E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 1.12E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 7.94E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 5.05E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 5.70E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 4.63E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202736323 NA 3.68E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251