Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202580538:

Variant ID: vg1202580538 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2580538
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACACCACCTAGATAGGAGAAGAGCCCCCGGTGAGTGTAACAGCATCTCCAACAGCCTCTCCAAATCGAACTCTCCAAACACCCATAAGCCAACTCTCC[G/A]
TCTGATTTAGCTAGTCAAACTAGATACTCACTCCAACAGACTCTCTATTAATCCTCTCCAAAATAAAATCGGACTCACATGTCAACATCTATCCCCTCTT

Reverse complement sequence

AAGAGGGGATAGATGTTGACATGTGAGTCCGATTTTATTTTGGAGAGGATTAATAGAGAGTCTGTTGGAGTGAGTATCTAGTTTGACTAGCTAAATCAGA[C/T]
GGAGAGTTGGCTTATGGGTGTTTGGAGAGTTCGATTTGGAGAGGCTGTTGGAGATGCTGTTACACTCACCGGGGGCTCTTCTCCTATCTAGGTGGTGTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	13.10%	0.00%	0.00%	NA
All Indica	2759	85.70%	14.30%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	22.30%	77.70%	0.00%	0.00%	NA
Indica I	595	95.60%	4.40%	0.00%	0.00%	NA
Indica II	465	86.50%	13.50%	0.00%	0.00%	NA
Indica III	913	83.90%	16.10%	0.00%	0.00%	NA
Indica Intermediate	786	79.90%	20.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202580538	G -> A	LOC_Os12g05609.1	upstream_gene_variant ; 4954.0bp to feature; MODIFIER	silent_mutation	Average:62.791; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1202580538	G -> A	LOC_Os12g05620.1	downstream_gene_variant ; 3356.0bp to feature; MODIFIER	silent_mutation	Average:62.791; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1202580538	G -> A	LOC_Os12g05609-LOC_Os12g05620	intergenic_region ; MODIFIER	silent_mutation	Average:62.791; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202580538	1.80E-06	1.21E-07	mr1071	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	5.36E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	4.19E-06	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	8.27E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	7.07E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	3.65E-06	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	8.33E-06	mr1400	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	2.16E-06	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	4.42E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	7.97E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	1.46E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	4.71E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	3.24E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202580538	NA	5.94E-06	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251