\
| Variant ID: vg1202580538 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2580538 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAACACCACCTAGATAGGAGAAGAGCCCCCGGTGAGTGTAACAGCATCTCCAACAGCCTCTCCAAATCGAACTCTCCAAACACCCATAAGCCAACTCTCC[G/A]
TCTGATTTAGCTAGTCAAACTAGATACTCACTCCAACAGACTCTCTATTAATCCTCTCCAAAATAAAATCGGACTCACATGTCAACATCTATCCCCTCTT
AAGAGGGGATAGATGTTGACATGTGAGTCCGATTTTATTTTGGAGAGGATTAATAGAGAGTCTGTTGGAGTGAGTATCTAGTTTGACTAGCTAAATCAGA[C/T]
GGAGAGTTGGCTTATGGGTGTTTGGAGAGTTCGATTTGGAGAGGCTGTTGGAGATGCTGTTACACTCACCGGGGGCTCTTCTCCTATCTAGGTGGTGTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 13.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.30% | 77.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.90% | 16.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.90% | 20.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202580538 | G -> A | LOC_Os12g05609.1 | upstream_gene_variant ; 4954.0bp to feature; MODIFIER | silent_mutation | Average:62.791; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1202580538 | G -> A | LOC_Os12g05620.1 | downstream_gene_variant ; 3356.0bp to feature; MODIFIER | silent_mutation | Average:62.791; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg1202580538 | G -> A | LOC_Os12g05609-LOC_Os12g05620 | intergenic_region ; MODIFIER | silent_mutation | Average:62.791; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202580538 | 1.80E-06 | 1.21E-07 | mr1071 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 5.36E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 4.19E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 8.27E-06 | mr1153 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 7.07E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 3.65E-06 | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 8.33E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 2.16E-06 | mr1438 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 4.42E-06 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 7.97E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 1.46E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 4.71E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 3.24E-06 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202580538 | NA | 5.94E-06 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |