\
| Variant ID: vg1202557972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2557972 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAAATTGTTGAGACTTGCAAAGTTTCTTTTGATGAGGCTAGTCCAGGTACTAGACCCGATATTGCAGGTACACTGTCACAGGTTCAGGGGGAGGATGAT[T/C]
GTATTTTTGAAGACGAGAGCAACGACAACGACAACGACAAGGTCGGCTCGGCCGGTTAGACCGGGCGCCAGGCCGGTCAGACCGCCGGCACACCTCCGGT
ACCGGAGGTGTGCCGGCGGTCTGACCGGCCTGGCGCCCGGTCTAACCGGCCGAGCCGACCTTGTCGTTGTCGTTGTCGTTGCTCTCGTCTTCAAAAATAC[A/G]
ATCATCCTCCCCCTGAACCTGTGACAGTGTACCTGCAATATCGGGTCTAGTACCTGGACTAGCCTCATCAAAAGAAACTTTGCAAGTCTCAACAATTTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 37.40% | 4.13% | 1.57% | NA |
| All Indica | 2759 | 92.90% | 2.80% | 2.86% | 1.52% | NA |
| All Japonica | 1512 | 2.20% | 97.70% | 0.07% | 0.07% | NA |
| Aus | 269 | 24.20% | 24.20% | 42.01% | 9.67% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 83.40% | 4.90% | 5.38% | 6.24% | NA |
| Indica III | 913 | 94.70% | 1.50% | 3.29% | 0.44% | NA |
| Indica Intermediate | 786 | 91.30% | 4.70% | 2.80% | 1.15% | NA |
| Temperate Japonica | 767 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.60% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 95.80% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 33.30% | 62.20% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202557972 | T -> C | LOC_Os12g05570.1 | missense_variant ; p.Cys435Arg; MODERATE | nonsynonymous_codon ; C435R | Average:39.455; most accessible tissue: Minghui63 root, score: 51.763 | unknown | unknown | TOLERATED | 0.46 |
| vg1202557972 | T -> DEL | LOC_Os12g05570.1 | N | frameshift_variant | Average:39.455; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202557972 | NA | 5.37E-25 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202557972 | NA | 5.88E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202557972 | NA | 3.59E-44 | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202557972 | NA | 2.83E-74 | mr1088_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202557972 | NA | 1.59E-34 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202557972 | NA | 2.97E-37 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202557972 | NA | 2.14E-38 | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202557972 | NA | 7.09E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202557972 | 2.85E-07 | NA | mr1865_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |