\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202504415:

Variant ID: vg1202504415 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2504415
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCCGATTGCCTTTATATCATTATCTACATTGGACATATAGCCAATTGCTTAAACCCTATCGCTATCGGCTGGTATTGGCATCGGCTATTATCGGCTAT[C/T]
GGCTGGAACTACTCCATCGGCTTGTCAGCCGATCGGTTGTTTTGTCTATTATTTGCATATCTTGTCAGTTGCAGGATCAAACTGACTGGCACGCCCGCAT

Reverse complement sequence

ATGCGGGCGTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATGCAAATAATAGACAAAACAACCGATCGGCTGACAAGCCGATGGAGTAGTTCCAGCC[G/A]
ATAGCCGATAATAGCCGATGCCAATACCAGCCGATAGCGATAGGGTTTAAGCAATTGGCTATATGTCCAATGTAGATAATGATATAAAGGCAATCGGCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 42.30% 0.83% 0.00% NA
All Indica  2759 94.20% 4.70% 1.09% 0.00% NA
All Japonica  1512 2.00% 97.90% 0.13% 0.00% NA
Aus  269 11.20% 87.40% 1.49% 0.00% NA
Indica I  595 98.70% 0.30% 1.01% 0.00% NA
Indica II  465 94.00% 5.40% 0.65% 0.00% NA
Indica III  913 94.40% 5.30% 0.33% 0.00% NA
Indica Intermediate  786 90.70% 7.00% 2.29% 0.00% NA
Temperate Japonica  767 3.00% 96.70% 0.26% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 32.20% 64.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202504415 C -> T LOC_Os12g05450.1 upstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:38.4; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg1202504415 C -> T LOC_Os12g05470.1 upstream_gene_variant ; 2523.0bp to feature; MODIFIER silent_mutation Average:38.4; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg1202504415 C -> T LOC_Os12g05480.1 downstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:38.4; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N
vg1202504415 C -> T LOC_Os12g05450-LOC_Os12g05470 intergenic_region ; MODIFIER silent_mutation Average:38.4; most accessible tissue: Minghui63 flag leaf, score: 57.881 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202504415 NA 7.84E-33 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 6.87E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 7.11E-49 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 1.02E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 4.80E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 4.89E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 9.95E-09 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 3.93E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 5.03E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 3.04E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 1.16E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 3.81E-06 NA mr1083_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 4.42E-75 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 9.32E-07 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 5.53E-06 NA mr1107_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 5.57E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 1.11E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 6.33E-39 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 8.68E-07 NA mr1226_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 9.32E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 9.36E-09 mr1241_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 5.23E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 1.17E-28 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 1.49E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 1.82E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 1.18E-06 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 1.19E-10 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 2.11E-39 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 1.09E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415 NA 5.16E-08 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251