Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202504415:

Variant ID: vg1202504415 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2504415
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCCGATTGCCTTTATATCATTATCTACATTGGACATATAGCCAATTGCTTAAACCCTATCGCTATCGGCTGGTATTGGCATCGGCTATTATCGGCTAT[C/T]
GGCTGGAACTACTCCATCGGCTTGTCAGCCGATCGGTTGTTTTGTCTATTATTTGCATATCTTGTCAGTTGCAGGATCAAACTGACTGGCACGCCCGCAT

Reverse complement sequence

ATGCGGGCGTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATGCAAATAATAGACAAAACAACCGATCGGCTGACAAGCCGATGGAGTAGTTCCAGCC[G/A]
ATAGCCGATAATAGCCGATGCCAATACCAGCCGATAGCGATAGGGTTTAAGCAATTGGCTATATGTCCAATGTAGATAATGATATAAAGGCAATCGGCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	42.30%	0.83%	0.00%	NA
All Indica	2759	94.20%	4.70%	1.09%	0.00%	NA
All Japonica	1512	2.00%	97.90%	0.13%	0.00%	NA
Aus	269	11.20%	87.40%	1.49%	0.00%	NA
Indica I	595	98.70%	0.30%	1.01%	0.00%	NA
Indica II	465	94.00%	5.40%	0.65%	0.00%	NA
Indica III	913	94.40%	5.30%	0.33%	0.00%	NA
Indica Intermediate	786	90.70%	7.00%	2.29%	0.00%	NA
Temperate Japonica	767	3.00%	96.70%	0.26%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	32.20%	64.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202504415	C -> T	LOC_Os12g05450.1	upstream_gene_variant ; 4730.0bp to feature; MODIFIER	silent_mutation	Average:38.4; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg1202504415	C -> T	LOC_Os12g05470.1	upstream_gene_variant ; 2523.0bp to feature; MODIFIER	silent_mutation	Average:38.4; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg1202504415	C -> T	LOC_Os12g05480.1	downstream_gene_variant ; 4494.0bp to feature; MODIFIER	silent_mutation	Average:38.4; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg1202504415	C -> T	LOC_Os12g05450-LOC_Os12g05470	intergenic_region ; MODIFIER	silent_mutation	Average:38.4; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202504415	NA	7.84E-33	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	6.87E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	7.11E-49	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	1.02E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	4.80E-33	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	4.89E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	9.95E-09	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	3.93E-08	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	5.03E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	3.04E-18	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	1.16E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	3.81E-06	NA	mr1083_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	4.42E-75	mr1088_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	9.32E-07	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	5.53E-06	NA	mr1107_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	5.57E-13	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	1.11E-37	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	6.33E-39	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	8.68E-07	NA	mr1226_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	9.32E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	9.36E-09	mr1241_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	5.23E-06	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	1.17E-28	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	1.49E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	1.82E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	1.18E-06	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	1.19E-10	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	2.11E-39	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	1.09E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202504415	NA	5.16E-08	mr1949_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251